Mutagenetix > Incidental Mutations

Incidental Mutation 'R4676:Olfr1504'

349626

Institutional Source

Beutler Lab

Gene Symbol

Olfr1504

Ensembl Gene

ENSMUSG00000059105

Gene Name

olfactory receptor 1504

Synonyms

MOR212-2, GA_x6K02T2RE5P-4223635-4222688

MMRRC Submission

042013-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.069) question?

Stock #

R4676 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

13886920-13897928 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 13887401 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 270 (D270N)

Ref Sequence

ENSEMBL: ENSMUSP00000146610 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078282] [ENSMUST00000209192]

Predicted Effect

probably damaging
Transcript: ENSMUST00000078282
AA Change: D270N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000077400
Gene: ENSMUSG00000059105
AA Change: D270N

Domain	Start	End	E-Value	Type
Pfam:7tm_4	30	307	4.3e-46	PFAM
Pfam:7tm_1	40	313	1.5e-19	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000209192
AA Change: D270N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

98% (93/95)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110009E18Rik	T	A	1: 120,150,652	I13N	probably damaging	Het
Abcd3	T	A	3: 121,774,166	T409S	possibly damaging	Het
Acad12	C	A	5: 121,607,171	W317L	probably damaging	Het
Acap1	T	A	11: 69,889,468	M50L	probably benign	Het
Acvr1b	T	A	15: 101,202,986	V343E	probably damaging	Het
Adgb	C	A	10: 10,426,710	G371W	probably damaging	Het
AF529169	A	G	9: 89,601,553	V597A	probably damaging	Het
Akap9	A	G	5: 4,032,774	K1966R	probably damaging	Het
Akap9	C	T	5: 4,064,515	Q48*	probably null	Het
Ano10	T	C	9: 122,263,787	R159G	probably damaging	Het
Anxa7	T	C	14: 20,467,915	M128V	probably benign	Het
Arhgef40	C	A	14: 51,990,959	C554*	probably null	Het
Asna1	C	T	8: 85,018,873	A219T	probably benign	Het
Atf6	T	C	1: 170,787,410	Y538C	probably damaging	Het
Atp8b1	A	C	18: 64,538,678	D1091E	probably benign	Het
BC034090	A	G	1: 155,226,264	Y85H	possibly damaging	Het
BC067074	C	A	13: 113,368,807	L2157I	probably damaging	Het
BC067074	T	G	13: 113,368,808	L2157R	probably damaging	Het
Bcas2	A	G	3: 103,175,701		probably benign	Het
Bnc2	T	C	4: 84,292,819	N463D	probably damaging	Het
Capn7	A	T	14: 31,359,259	H411L	possibly damaging	Het
Cavin3	T	C	7: 105,481,113	E164G	probably damaging	Het
Ccdc191	T	C	16: 43,939,173		probably benign	Het
Ccdc88b	A	G	19: 6,853,000	V858A	probably benign	Het
Clcn3	A	G	8: 60,930,651		probably benign	Het
Commd6	T	C	14: 101,640,284		probably benign	Het
Cul3	G	A	1: 80,271,674	L561F	probably damaging	Het
Cyfip1	T	A	7: 55,875,013	I131N	probably damaging	Het
Dlgap3	T	A	4: 127,233,761	Y741N	probably damaging	Het
Dnah5	A	T	15: 28,295,260	I1380F	possibly damaging	Het
Dync1h1	G	T	12: 110,662,541	L4177F	probably damaging	Het
Ethe1	G	A	7: 24,607,894	V178M	probably damaging	Het
Flnc	A	T	6: 29,445,154		probably null	Het
Glt8d1	T	C	14: 31,006,692	F26L	probably benign	Het
Gm5493	T	A	17: 22,748,081	D63E	probably benign	Het
Gm9996	T	A	10: 29,143,838		probably benign	Het
Gnl2	T	G	4: 125,053,473	S629R	possibly damaging	Het
Gpbp1l1	T	C	4: 116,590,265	S381P	probably damaging	Het
Igsf10	A	C	3: 59,325,949	F1788V	probably benign	Het
Inpp5d	C	A	1: 87,715,142	P935Q	probably damaging	Het
Itch	A	C	2: 155,199,435	I468L	probably benign	Het
Itga5	A	T	15: 103,357,210	Y192N	probably damaging	Het
Itih3	T	A	14: 30,918,949	Q302L	probably null	Het
Itih3	T	A	14: 30,921,686	Q121L	possibly damaging	Het
Kctd17	T	A	15: 78,435,759		probably benign	Het
Lsm1	T	C	8: 25,793,689	L43P	probably damaging	Het
Magi3	A	T	3: 104,015,825	M1192K	probably benign	Het
Mecom	A	G	3: 30,268,668		probably benign	Het
Mtmr3	A	T	11: 4,527,855	F63Y	probably benign	Het
Naa16	A	G	14: 79,336,348		probably benign	Het
Neto1	A	T	18: 86,398,302	T45S	possibly damaging	Het
Nlrp4a	A	T	7: 26,450,229	R420S	probably damaging	Het
Nr1h4	T	C	10: 89,473,874	D317G	probably damaging	Het
Olfr1497	T	A	19: 13,795,474	I46F	possibly damaging	Het
Olfr920	A	G	9: 38,755,659		probably benign	Het
Pde5a	A	T	3: 122,747,893	M11L	possibly damaging	Het
Plxnb1	G	A	9: 109,110,435	R1416Q	possibly damaging	Het
Polm	A	T	11: 5,835,749	Y141*	probably null	Het
Rxfp1	A	G	3: 79,705,668	F32L	probably damaging	Het
Scrt1	T	A	15: 76,521,668	D13V	possibly damaging	Het
Slc1a7	T	A	4: 107,977,674	V79E	possibly damaging	Het
Snurf	T	C	7: 59,995,522	Q48R	probably benign	Het
Srek1	T	C	13: 103,758,187		probably benign	Het
Stxbp5l	T	C	16: 37,255,884	S267G	probably damaging	Het
Taf5	C	T	19: 47,074,970	R320W	probably damaging	Het
Tars2	A	T	3: 95,753,091	N106K	probably damaging	Het
Tatdn3	A	T	1: 191,049,334	L207Q	probably damaging	Het
Tdrd6	T	C	17: 43,627,610	E849G	probably damaging	Het
Tedc2	T	C	17: 24,220,011	T111A	probably benign	Het
Tfg	T	A	16: 56,694,491		probably null	Het
Tgds	A	T	14: 118,116,231	S225T	probably benign	Het
Tnks2	T	A	19: 36,875,271	Y134*	probably null	Het
Trappc1	T	A	11: 69,325,530	V134D	probably damaging	Het
Ttc3	C	A	16: 94,442,761	P853Q	probably damaging	Het
Ttc7	C	A	17: 87,370,735		probably benign	Het
Ttf1	A	G	2: 29,074,594	S643G	probably damaging	Het
Tubgcp3	A	T	8: 12,650,171	S338T	probably damaging	Het
Ugt1a6a	T	C	1: 88,139,285	I271T	possibly damaging	Het
Vipas39	T	A	12: 87,241,301	Y445F	probably damaging	Het
Vmn1r31	A	C	6: 58,472,013	I289S	probably damaging	Het
Wdr92	T	C	11: 17,229,794	V265A	probably benign	Het
Zfp112	A	G	7: 24,126,260	E551G	probably damaging	Het
Zfp397	T	A	18: 23,960,797	Y446*	probably null	Het
Zfp442	A	T	2: 150,409,606	H124Q	probably damaging	Het

Other mutations in Olfr1504

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Olfr1504	APN	19	13887581	missense	probably benign
IGL00885:Olfr1504	APN	19	13888168	missense	probably benign	0.17
IGL01084:Olfr1504	APN	19	13887502	missense	probably damaging	1.00
IGL01522:Olfr1504	APN	19	13887358	nonsense	probably null
IGL01727:Olfr1504	APN	19	13887878	missense	probably damaging	0.98
IGL02440:Olfr1504	APN	19	13887859	missense	probably damaging	1.00
IGL03342:Olfr1504	APN	19	13887437	missense	probably damaging	1.00
R0531:Olfr1504	UTSW	19	13887752	missense	possibly damaging	0.62
R0577:Olfr1504	UTSW	19	13887803	missense	probably damaging	1.00
R1028:Olfr1504	UTSW	19	13887795	missense	probably damaging	0.97
R1674:Olfr1504	UTSW	19	13887590	missense	probably benign	0.01
R3906:Olfr1504	UTSW	19	13887706	missense	probably damaging	1.00
R4598:Olfr1504	UTSW	19	13888017	missense	probably damaging	1.00
R4658:Olfr1504	UTSW	19	13887548	missense	probably benign	0.19
R5919:Olfr1504	UTSW	19	13887845	missense	probably damaging	1.00
R5943:Olfr1504	UTSW	19	13887752	missense	possibly damaging	0.62
R8112:Olfr1504	UTSW	19	13887389	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCAACAGATAGGAACTTCGGAC -3'
(R):5'- TTGCCTGTAGTGAGACCAAG -3'

Sequencing Primer
(F):5'- CGGACTGATGAAGCTTTAAGTC -3'
(R):5'- TTGCCTGTAGTGAGACCAAGTTACAG -3'

Posted On

2015-10-08