Incidental Mutation 'R4676:Tnks2'
ID 349627
Institutional Source Beutler Lab
Gene Symbol Tnks2
Ensembl Gene ENSMUSG00000024811
Gene Name tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2
Synonyms 5430432P15Rik
MMRRC Submission 042013-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4676 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 36811632-36870877 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 36852671 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 134 (Y134*)
Ref Sequence ENSEMBL: ENSMUSP00000132440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025729] [ENSMUST00000164665] [ENSMUST00000167724]
AlphaFold Q3UES3
Predicted Effect probably null
Transcript: ENSMUST00000025729
AA Change: Y689*
SMART Domains Protein: ENSMUSP00000025729
Gene: ENSMUSG00000024811
AA Change: Y689*

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
ANK 57 86 8.07e-5 SMART
ANK 90 119 1.78e-6 SMART
ANK 123 152 6.46e-4 SMART
ANK 210 239 1.76e-5 SMART
ANK 243 272 3.91e-3 SMART
ANK 276 305 3.23e-4 SMART
ANK 363 395 1.57e-2 SMART
ANK 399 428 4.5e-3 SMART
ANK 432 461 4.89e-4 SMART
ANK 525 554 1.43e-5 SMART
ANK 558 587 6.55e-5 SMART
ANK 591 620 1.24e-5 SMART
low complexity region 641 659 N/A INTRINSIC
ANK 678 707 1.69e-7 SMART
ANK 711 740 3.65e-3 SMART
ANK 744 773 3.36e-2 SMART
low complexity region 822 863 N/A INTRINSIC
SAM 870 936 1.03e-10 SMART
Pfam:PARP 952 1157 4.9e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000164665
AA Change: Y134*
SMART Domains Protein: ENSMUSP00000132440
Gene: ENSMUSG00000024811
AA Change: Y134*

DomainStartEndE-ValueType
ANK 3 32 6.55e-5 SMART
ANK 36 65 1.24e-5 SMART
low complexity region 86 104 N/A INTRINSIC
ANK 123 152 1.69e-7 SMART
ANK 156 185 9.05e2 SMART
low complexity region 204 245 N/A INTRINSIC
SAM 252 318 1.03e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166677
Predicted Effect probably benign
Transcript: ENSMUST00000167724
SMART Domains Protein: ENSMUSP00000126888
Gene: ENSMUSG00000024811

DomainStartEndE-ValueType
ANK 84 113 4.89e-4 SMART
Blast:ANK 143 171 9e-10 BLAST
ANK 177 206 1.43e-5 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (93/95)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele are viable but display decreased body weight and abnormal adipocyte glucose uptake in response to insulin stimulation. Mice homozygous for a different null allele show partial postnatal lethality as well as decreased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik T A 1: 120,078,382 (GRCm39) I13N probably damaging Het
Abcd3 T A 3: 121,567,815 (GRCm39) T409S possibly damaging Het
Acad12 C A 5: 121,745,234 (GRCm39) W317L probably damaging Het
Acap1 T A 11: 69,780,294 (GRCm39) M50L probably benign Het
Acvr1b T A 15: 101,100,867 (GRCm39) V343E probably damaging Het
Adgb C A 10: 10,302,454 (GRCm39) G371W probably damaging Het
Akap9 A G 5: 4,082,774 (GRCm39) K1966R probably damaging Het
Akap9 C T 5: 4,114,515 (GRCm39) Q48* probably null Het
Ano10 T C 9: 122,092,853 (GRCm39) R159G probably damaging Het
Anxa7 T C 14: 20,517,983 (GRCm39) M128V probably benign Het
Arhgef40 C A 14: 52,228,416 (GRCm39) C554* probably null Het
Atf6 T C 1: 170,614,979 (GRCm39) Y538C probably damaging Het
Atp8b1 A C 18: 64,671,749 (GRCm39) D1091E probably benign Het
BC034090 A G 1: 155,102,010 (GRCm39) Y85H possibly damaging Het
Bcas2 A G 3: 103,083,017 (GRCm39) probably benign Het
Bnc2 T C 4: 84,211,056 (GRCm39) N463D probably damaging Het
Capn7 A T 14: 31,081,216 (GRCm39) H411L possibly damaging Het
Cavin3 T C 7: 105,130,320 (GRCm39) E164G probably damaging Het
Ccdc191 T C 16: 43,759,536 (GRCm39) probably benign Het
Ccdc88b A G 19: 6,830,368 (GRCm39) V858A probably benign Het
Clcn3 A G 8: 61,383,685 (GRCm39) probably benign Het
Commd6 T C 14: 101,877,720 (GRCm39) probably benign Het
Cspg4b C A 13: 113,505,341 (GRCm39) L2157I probably damaging Het
Cspg4b T G 13: 113,505,342 (GRCm39) L2157R probably damaging Het
Cul3 G A 1: 80,249,391 (GRCm39) L561F probably damaging Het
Cyfip1 T A 7: 55,524,761 (GRCm39) I131N probably damaging Het
Dlgap3 T A 4: 127,127,554 (GRCm39) Y741N probably damaging Het
Dnaaf10 T C 11: 17,179,794 (GRCm39) V265A probably benign Het
Dnah5 A T 15: 28,295,406 (GRCm39) I1380F possibly damaging Het
Dync1h1 G T 12: 110,628,975 (GRCm39) L4177F probably damaging Het
Ethe1 G A 7: 24,307,319 (GRCm39) V178M probably damaging Het
Flnc A T 6: 29,445,153 (GRCm39) probably null Het
Get3 C T 8: 85,745,502 (GRCm39) A219T probably benign Het
Glt8d1 T C 14: 30,728,649 (GRCm39) F26L probably benign Het
Gm5493 T A 17: 22,967,054 (GRCm39) D63E probably benign Het
Gm9996 T A 10: 29,019,834 (GRCm39) probably benign Het
Gnl2 T G 4: 124,947,266 (GRCm39) S629R possibly damaging Het
Gpbp1l1 T C 4: 116,447,462 (GRCm39) S381P probably damaging Het
Igsf10 A C 3: 59,233,370 (GRCm39) F1788V probably benign Het
Inpp5d C A 1: 87,642,864 (GRCm39) P935Q probably damaging Het
Itch A C 2: 155,041,355 (GRCm39) I468L probably benign Het
Itga5 A T 15: 103,265,637 (GRCm39) Y192N probably damaging Het
Itih3 T A 14: 30,640,906 (GRCm39) Q302L probably null Het
Itih3 T A 14: 30,643,643 (GRCm39) Q121L possibly damaging Het
Kctd17 T A 15: 78,319,959 (GRCm39) probably benign Het
Lsm1 T C 8: 26,283,717 (GRCm39) L43P probably damaging Het
Magi3 A T 3: 103,923,141 (GRCm39) M1192K probably benign Het
Mecom A G 3: 30,322,817 (GRCm39) probably benign Het
Minar1 A G 9: 89,483,606 (GRCm39) V597A probably damaging Het
Mtmr3 A T 11: 4,477,855 (GRCm39) F63Y probably benign Het
Naa16 A G 14: 79,573,788 (GRCm39) probably benign Het
Neto1 A T 18: 86,416,427 (GRCm39) T45S possibly damaging Het
Nlrp4a A T 7: 26,149,654 (GRCm39) R420S probably damaging Het
Nr1h4 T C 10: 89,309,736 (GRCm39) D317G probably damaging Het
Or8b53 A G 9: 38,666,955 (GRCm39) probably benign Het
Or9i16 C T 19: 13,864,765 (GRCm39) D270N probably damaging Het
Or9q2 T A 19: 13,772,838 (GRCm39) I46F possibly damaging Het
Pde5a A T 3: 122,541,542 (GRCm39) M11L possibly damaging Het
Plxnb1 G A 9: 108,939,503 (GRCm39) R1416Q possibly damaging Het
Polm A T 11: 5,785,749 (GRCm39) Y141* probably null Het
Rxfp1 A G 3: 79,612,975 (GRCm39) F32L probably damaging Het
Scrt1 T A 15: 76,405,868 (GRCm39) D13V possibly damaging Het
Slc1a7 T A 4: 107,834,871 (GRCm39) V79E possibly damaging Het
Snurf T C 7: 59,645,270 (GRCm39) Q48R probably benign Het
Srek1 T C 13: 103,894,695 (GRCm39) probably benign Het
Stxbp5l T C 16: 37,076,246 (GRCm39) S267G probably damaging Het
Taf5 C T 19: 47,063,409 (GRCm39) R320W probably damaging Het
Tars2 A T 3: 95,660,403 (GRCm39) N106K probably damaging Het
Tatdn3 A T 1: 190,781,531 (GRCm39) L207Q probably damaging Het
Tdrd6 T C 17: 43,938,501 (GRCm39) E849G probably damaging Het
Tedc2 T C 17: 24,438,985 (GRCm39) T111A probably benign Het
Tfg T A 16: 56,514,854 (GRCm39) probably null Het
Tgds A T 14: 118,353,643 (GRCm39) S225T probably benign Het
Trappc1 T A 11: 69,216,356 (GRCm39) V134D probably damaging Het
Ttc3 C A 16: 94,243,620 (GRCm39) P853Q probably damaging Het
Ttc7 C A 17: 87,678,163 (GRCm39) probably benign Het
Ttf1 A G 2: 28,964,606 (GRCm39) S643G probably damaging Het
Tubgcp3 A T 8: 12,700,171 (GRCm39) S338T probably damaging Het
Ugt1a6a T C 1: 88,067,007 (GRCm39) I271T possibly damaging Het
Vipas39 T A 12: 87,288,075 (GRCm39) Y445F probably damaging Het
Vmn1r31 A C 6: 58,448,998 (GRCm39) I289S probably damaging Het
Zfp112 A G 7: 23,825,685 (GRCm39) E551G probably damaging Het
Zfp397 T A 18: 24,093,854 (GRCm39) Y446* probably null Het
Zfp442 A T 2: 150,251,526 (GRCm39) H124Q probably damaging Het
Other mutations in Tnks2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Tnks2 APN 19 36,849,033 (GRCm39) missense probably benign 0.00
IGL01977:Tnks2 APN 19 36,849,990 (GRCm39) critical splice donor site probably null
IGL02389:Tnks2 APN 19 36,861,503 (GRCm39) missense probably benign 0.32
IGL02653:Tnks2 APN 19 36,849,851 (GRCm39) missense probably damaging 1.00
IGL02678:Tnks2 APN 19 36,823,143 (GRCm39) missense possibly damaging 0.63
R0053:Tnks2 UTSW 19 36,852,765 (GRCm39) missense probably damaging 1.00
R0053:Tnks2 UTSW 19 36,852,765 (GRCm39) missense probably damaging 1.00
R0426:Tnks2 UTSW 19 36,830,221 (GRCm39) missense probably damaging 1.00
R0436:Tnks2 UTSW 19 36,826,758 (GRCm39) missense possibly damaging 0.51
R0591:Tnks2 UTSW 19 36,849,962 (GRCm39) missense probably damaging 0.99
R0648:Tnks2 UTSW 19 36,839,474 (GRCm39) splice site probably null
R0894:Tnks2 UTSW 19 36,867,450 (GRCm39) critical splice donor site probably null
R1397:Tnks2 UTSW 19 36,857,901 (GRCm39) splice site probably benign
R1459:Tnks2 UTSW 19 36,822,931 (GRCm39) splice site probably benign
R1674:Tnks2 UTSW 19 36,849,022 (GRCm39) missense probably benign 0.03
R1742:Tnks2 UTSW 19 36,853,661 (GRCm39) missense probably damaging 1.00
R1928:Tnks2 UTSW 19 36,823,068 (GRCm39) nonsense probably null
R2025:Tnks2 UTSW 19 36,843,466 (GRCm39) missense probably damaging 0.99
R2898:Tnks2 UTSW 19 36,849,990 (GRCm39) critical splice donor site probably null
R4422:Tnks2 UTSW 19 36,823,053 (GRCm39) missense probably damaging 1.00
R5202:Tnks2 UTSW 19 36,866,252 (GRCm39) missense probably damaging 1.00
R5357:Tnks2 UTSW 19 36,826,690 (GRCm39) splice site silent
R5467:Tnks2 UTSW 19 36,859,176 (GRCm39) missense probably damaging 1.00
R5550:Tnks2 UTSW 19 36,839,746 (GRCm39) missense probably damaging 1.00
R6119:Tnks2 UTSW 19 36,856,752 (GRCm39) missense possibly damaging 0.79
R6219:Tnks2 UTSW 19 36,843,604 (GRCm39) intron probably benign
R7270:Tnks2 UTSW 19 36,836,545 (GRCm39) missense
R7309:Tnks2 UTSW 19 36,829,936 (GRCm39) missense probably damaging 1.00
R7310:Tnks2 UTSW 19 36,856,839 (GRCm39) missense probably benign 0.12
R7516:Tnks2 UTSW 19 36,849,064 (GRCm39) missense possibly damaging 0.85
R7823:Tnks2 UTSW 19 36,829,954 (GRCm39) critical splice donor site probably null
R7951:Tnks2 UTSW 19 36,839,555 (GRCm39) missense
R7961:Tnks2 UTSW 19 36,829,901 (GRCm39) missense probably benign 0.15
R8009:Tnks2 UTSW 19 36,829,901 (GRCm39) missense probably benign 0.15
R8193:Tnks2 UTSW 19 36,832,353 (GRCm39) missense possibly damaging 0.70
R8919:Tnks2 UTSW 19 36,823,088 (GRCm39) missense probably damaging 0.97
R9329:Tnks2 UTSW 19 36,835,284 (GRCm39) missense probably damaging 1.00
Z1177:Tnks2 UTSW 19 36,866,280 (GRCm39) missense probably benign 0.10
Z1177:Tnks2 UTSW 19 36,811,977 (GRCm39) missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- AGCTTCTAACATTTTAGTCCAGTGG -3'
(R):5'- CATCAAGTAAGAGACAGGTGCC -3'

Sequencing Primer
(F):5'- AATATTTAGGCATGTGGGTG -3'
(R):5'- GTGCCAAGGACAAAAATATATTGCC -3'
Posted On 2015-10-08