Incidental Mutation 'R4677:Ddx55'
ID349648
Institutional Source Beutler Lab
Gene Symbol Ddx55
Ensembl Gene ENSMUSG00000029389
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 55
Synonyms2810021H22Rik
MMRRC Submission 042014-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4677 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location124552864-124569660 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 124567934 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 474 (D474V)
Ref Sequence ENSEMBL: ENSMUSP00000107065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031334] [ENSMUST00000071057] [ENSMUST00000111438] [ENSMUST00000131631]
Predicted Effect probably benign
Transcript: ENSMUST00000031334
SMART Domains Protein: ENSMUSP00000031334
Gene: ENSMUSG00000029388

DomainStartEndE-ValueType
Pfam:IF-2B 14 293 2.3e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071057
AA Change: D478V

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000070279
Gene: ENSMUSG00000029389
AA Change: D478V

DomainStartEndE-ValueType
DEXDc 28 245 3.15e-51 SMART
HELICc 281 363 3.69e-25 SMART
DUF4217 402 465 1.44e-26 SMART
low complexity region 491 506 N/A INTRINSIC
low complexity region 517 540 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111438
AA Change: D474V

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000107065
Gene: ENSMUSG00000029389
AA Change: D474V

DomainStartEndE-ValueType
DEXDc 28 245 3.15e-51 SMART
HELICc 281 363 3.69e-25 SMART
DUF4217 398 461 1.44e-26 SMART
low complexity region 487 502 N/A INTRINSIC
low complexity region 513 536 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131631
SMART Domains Protein: ENSMUSP00000143462
Gene: ENSMUSG00000029389

DomainStartEndE-ValueType
Pfam:DEAD 33 125 6.4e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142451
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152716
Meta Mutation Damage Score 0.0779 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 100% (85/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of protein family containing a characteristic Asp-Glu-Ala-Asp (DEAD) motif. These proteins are putative RNA helicases, and may be involved in a range of nuclear processes including translational initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Multiple alternatively spliced transcript variants have been found for this gene. Pseudogenes have been identified on chromosomes 1 and 12. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik A T 9: 94,520,404 C402S probably damaging Het
Adamts9 T C 6: 92,816,606 M1T probably null Het
Akap3 T C 6: 126,865,263 S282P probably damaging Het
Anxa10 A G 8: 62,063,020 I206T probably damaging Het
Apobec3 A G 15: 79,895,512 D52G probably damaging Het
Arl6 A T 16: 59,618,865 probably null Het
BC067074 A G 13: 113,379,486 T145A unknown Het
Calcoco1 T C 15: 102,717,894 E87G probably damaging Het
Ccdc88b C A 19: 6,848,268 A1206S probably damaging Het
Ccpg1 A G 9: 73,015,915 probably benign Het
Cdon A G 9: 35,478,605 N852D probably damaging Het
Cobl T A 11: 12,386,665 Q41L possibly damaging Het
Dcdc2b T C 4: 129,614,143 T39A probably damaging Het
Dnah17 A G 11: 118,119,814 L521P probably damaging Het
Exoc1 A G 5: 76,559,163 D497G probably null Het
Fam151a A G 4: 106,748,259 E606G possibly damaging Het
Fbxw11 T A 11: 32,742,535 L502* probably null Het
Fcrl1 A G 3: 87,390,256 S337G possibly damaging Het
G6pc C A 11: 101,376,613 F296L probably benign Het
Gm17472 C A 6: 42,980,875 T26N probably damaging Het
Gm9573 T A 17: 35,619,707 probably benign Het
Grin2b A G 6: 135,774,872 V564A probably benign Het
H2-Ob T C 17: 34,242,644 I119T probably benign Het
Hhip A G 8: 80,045,097 Y195H probably damaging Het
Igkc A T 6: 70,726,678 probably benign Het
Islr A T 9: 58,157,359 D288E probably damaging Het
Kdelr1 A G 7: 45,873,773 S36G probably benign Het
Lama5 G T 2: 180,179,366 H3134Q possibly damaging Het
Lor A G 3: 92,081,743 Y79H unknown Het
Lrp1b A G 2: 40,801,484 F3327S probably damaging Het
Lrrc41 C T 4: 116,095,135 H637Y probably benign Het
Map2k6 C T 11: 110,399,394 probably benign Het
Mcm3ap T G 10: 76,470,570 F172L probably damaging Het
Muc19 G A 15: 91,888,217 noncoding transcript Het
Muc6 T A 7: 141,639,790 probably benign Het
Nek1 A T 8: 61,028,806 I252L probably damaging Het
Nrg2 A T 18: 36,021,099 H588Q possibly damaging Het
Nt5dc2 T C 14: 31,138,921 V351A possibly damaging Het
Olfr1030 A G 2: 85,983,971 T44A possibly damaging Het
Olfr1046 A T 2: 86,217,688 S7R probably benign Het
Olfr340 A G 2: 36,453,050 N155S probably benign Het
Olfr64 T C 7: 103,893,408 E109G probably damaging Het
Pde3a A G 6: 141,466,139 N480D probably benign Het
Pde6c A G 19: 38,157,385 K374E probably damaging Het
Pdhx G A 2: 103,073,466 probably null Het
Pi4ka A G 16: 17,282,373 Y1888H probably damaging Het
Pnpla2 T A 7: 141,458,443 M203K probably damaging Het
Prrc2c C T 1: 162,705,179 probably benign Het
Ptcd3 G T 6: 71,893,514 H321N probably benign Het
Ptprt A G 2: 161,901,446 probably null Het
Ptx4 A G 17: 25,123,126 T192A probably benign Het
Qars A G 9: 108,509,690 probably benign Het
Ralgapa2 G A 2: 146,345,467 P1372S possibly damaging Het
Rps6ka4 G T 19: 6,839,486 T107K probably damaging Het
Rsf1 A G 7: 97,680,773 T1169A possibly damaging Het
Ryr2 C A 13: 11,706,667 W2626L probably damaging Het
Scn4a C T 11: 106,323,962 V1270I probably damaging Het
Serpinb9b T C 13: 33,039,823 S333P probably damaging Het
Sned1 A G 1: 93,296,297 probably benign Het
Sult1c2 C T 17: 53,830,109 V262M possibly damaging Het
Tll1 A T 8: 64,051,377 F662I probably benign Het
Tmem161a A T 8: 70,180,947 probably null Het
Top1mt A C 15: 75,664,058 V465G possibly damaging Het
Trcg1 A G 9: 57,245,861 K596E possibly damaging Het
Trim27 T A 13: 21,180,916 probably null Het
Trpm3 A G 19: 22,987,388 I1406V possibly damaging Het
Tssc4 T A 7: 143,070,509 S254T probably damaging Het
Ttc7 C A 17: 87,370,735 probably benign Het
Usp30 A G 5: 114,119,644 T288A probably damaging Het
Usp48 C A 4: 137,616,381 R441S probably benign Het
Vmn1r29 T C 6: 58,307,300 S2P probably benign Het
Vmn2r65 T A 7: 84,963,874 I46L possibly damaging Het
Zeb1 A T 18: 5,766,775 I429F probably damaging Het
Zfp943 A G 17: 21,993,195 R421G probably benign Het
Other mutations in Ddx55
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02237:Ddx55 APN 5 124567895 missense probably damaging 1.00
IGL03356:Ddx55 APN 5 124554753 missense possibly damaging 0.95
R0100:Ddx55 UTSW 5 124556782 missense probably damaging 1.00
R0100:Ddx55 UTSW 5 124556782 missense probably damaging 1.00
R0329:Ddx55 UTSW 5 124559147 missense probably benign 0.00
R0401:Ddx55 UTSW 5 124567951 missense probably damaging 1.00
R1604:Ddx55 UTSW 5 124559306 missense probably damaging 1.00
R1760:Ddx55 UTSW 5 124568113 missense probably damaging 0.99
R2002:Ddx55 UTSW 5 124566440 missense probably damaging 1.00
R2292:Ddx55 UTSW 5 124568077 missense probably benign 0.00
R4735:Ddx55 UTSW 5 124566476 missense probably damaging 1.00
R4745:Ddx55 UTSW 5 124566965 nonsense probably null
R4941:Ddx55 UTSW 5 124568716 nonsense probably null
R5272:Ddx55 UTSW 5 124558029 missense possibly damaging 0.91
R5348:Ddx55 UTSW 5 124554565 missense probably damaging 0.96
R5514:Ddx55 UTSW 5 124556812 missense probably damaging 1.00
R5801:Ddx55 UTSW 5 124566497 critical splice donor site probably null
R5806:Ddx55 UTSW 5 124559199 missense probably damaging 1.00
R5869:Ddx55 UTSW 5 124568682 missense probably benign
R5909:Ddx55 UTSW 5 124566850 missense probably benign 0.00
R6594:Ddx55 UTSW 5 124566925 missense probably damaging 1.00
R6737:Ddx55 UTSW 5 124552945 missense probably damaging 1.00
R7257:Ddx55 UTSW 5 124560721 missense possibly damaging 0.67
R7262:Ddx55 UTSW 5 124566856 missense probably benign
R8049:Ddx55 UTSW 5 124556758 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCTGCCATTTCCACCTTGA -3'
(R):5'- CAATGTCACAAGGTGGAGTTG -3'

Sequencing Primer
(F):5'- TGTAATGGGATCCAATGCCC -3'
(R):5'- CAGAAGTTTCTGCCTCTG -3'
Posted On2015-10-08