Incidental Mutation 'R4677:Fbxw11'
ID349680
Institutional Source Beutler Lab
Gene Symbol Fbxw11
Ensembl Gene ENSMUSG00000020271
Gene NameF-box and WD-40 domain protein 11
SynonymsHOS, 2310065A07Rik, Fbxw1b, BTRC2, BTRCP2
MMRRC Submission 042014-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R4677 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location32642724-32746816 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 32742535 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 502 (L502*)
Ref Sequence ENSEMBL: ENSMUSP00000104991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076383] [ENSMUST00000093205] [ENSMUST00000109366]
Predicted Effect probably null
Transcript: ENSMUST00000076383
AA Change: L536*
SMART Domains Protein: ENSMUSP00000075721
Gene: ENSMUSG00000020271
AA Change: L536*

DomainStartEndE-ValueType
Beta-TrCP_D 98 137 5.48e-26 SMART
FBOX 149 188 5.08e-6 SMART
WD40 250 287 6.89e-3 SMART
WD40 290 327 3.78e-9 SMART
WD40 330 367 7.73e-6 SMART
WD40 373 410 9.67e-7 SMART
WD40 413 450 3.93e-7 SMART
WD40 453 490 8.42e-7 SMART
WD40 502 539 2.48e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000093205
AA Change: L515*
SMART Domains Protein: ENSMUSP00000090893
Gene: ENSMUSG00000020271
AA Change: L515*

DomainStartEndE-ValueType
Beta-TrCP_D 77 116 5.48e-26 SMART
FBOX 128 167 5.08e-6 SMART
WD40 229 266 6.89e-3 SMART
WD40 269 306 3.78e-9 SMART
WD40 309 346 7.73e-6 SMART
WD40 352 389 9.67e-7 SMART
WD40 392 429 3.93e-7 SMART
WD40 432 469 8.42e-7 SMART
WD40 481 518 2.48e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109366
AA Change: L502*
SMART Domains Protein: ENSMUSP00000104991
Gene: ENSMUSG00000020271
AA Change: L502*

DomainStartEndE-ValueType
Beta-TrCP_D 64 103 5.48e-26 SMART
FBOX 115 154 5.08e-6 SMART
WD40 216 253 6.89e-3 SMART
WD40 256 293 3.78e-9 SMART
WD40 296 333 7.73e-6 SMART
WD40 339 376 9.67e-7 SMART
WD40 379 416 3.93e-7 SMART
WD40 419 456 8.42e-7 SMART
WD40 468 505 2.48e-4 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 100% (85/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbws class and, in addition to an F-box, contains multiple WD40 repeats. This gene contains at least 14 exons, and its alternative splicing generates 3 transcript variants diverging at the presence/absence of two alternate exons. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik A T 9: 94,520,404 C402S probably damaging Het
Adamts9 T C 6: 92,816,606 M1T probably null Het
Akap3 T C 6: 126,865,263 S282P probably damaging Het
Anxa10 A G 8: 62,063,020 I206T probably damaging Het
Apobec3 A G 15: 79,895,512 D52G probably damaging Het
Arl6 A T 16: 59,618,865 probably null Het
BC067074 A G 13: 113,379,486 T145A unknown Het
Calcoco1 T C 15: 102,717,894 E87G probably damaging Het
Ccdc88b C A 19: 6,848,268 A1206S probably damaging Het
Ccpg1 A G 9: 73,015,915 probably benign Het
Cdon A G 9: 35,478,605 N852D probably damaging Het
Cobl T A 11: 12,386,665 Q41L possibly damaging Het
Dcdc2b T C 4: 129,614,143 T39A probably damaging Het
Ddx55 A T 5: 124,567,934 D474V probably benign Het
Dnah17 A G 11: 118,119,814 L521P probably damaging Het
Exoc1 A G 5: 76,559,163 D497G probably null Het
Fam151a A G 4: 106,748,259 E606G possibly damaging Het
Fcrl1 A G 3: 87,390,256 S337G possibly damaging Het
G6pc C A 11: 101,376,613 F296L probably benign Het
Gm17472 C A 6: 42,980,875 T26N probably damaging Het
Gm9573 T A 17: 35,619,707 probably benign Het
Grin2b A G 6: 135,774,872 V564A probably benign Het
H2-Ob T C 17: 34,242,644 I119T probably benign Het
Hhip A G 8: 80,045,097 Y195H probably damaging Het
Igkc A T 6: 70,726,678 probably benign Het
Islr A T 9: 58,157,359 D288E probably damaging Het
Kdelr1 A G 7: 45,873,773 S36G probably benign Het
Lama5 G T 2: 180,179,366 H3134Q possibly damaging Het
Lor A G 3: 92,081,743 Y79H unknown Het
Lrp1b A G 2: 40,801,484 F3327S probably damaging Het
Lrrc41 C T 4: 116,095,135 H637Y probably benign Het
Map2k6 C T 11: 110,399,394 probably benign Het
Mcm3ap T G 10: 76,470,570 F172L probably damaging Het
Muc19 G A 15: 91,888,217 noncoding transcript Het
Muc6 T A 7: 141,639,790 probably benign Het
Nek1 A T 8: 61,028,806 I252L probably damaging Het
Nrg2 A T 18: 36,021,099 H588Q possibly damaging Het
Nt5dc2 T C 14: 31,138,921 V351A possibly damaging Het
Olfr1030 A G 2: 85,983,971 T44A possibly damaging Het
Olfr1046 A T 2: 86,217,688 S7R probably benign Het
Olfr340 A G 2: 36,453,050 N155S probably benign Het
Olfr64 T C 7: 103,893,408 E109G probably damaging Het
Pde3a A G 6: 141,466,139 N480D probably benign Het
Pde6c A G 19: 38,157,385 K374E probably damaging Het
Pdhx G A 2: 103,073,466 probably null Het
Pi4ka A G 16: 17,282,373 Y1888H probably damaging Het
Pnpla2 T A 7: 141,458,443 M203K probably damaging Het
Prrc2c C T 1: 162,705,179 probably benign Het
Ptcd3 G T 6: 71,893,514 H321N probably benign Het
Ptprt A G 2: 161,901,446 probably null Het
Ptx4 A G 17: 25,123,126 T192A probably benign Het
Qars A G 9: 108,509,690 probably benign Het
Ralgapa2 G A 2: 146,345,467 P1372S possibly damaging Het
Rps6ka4 G T 19: 6,839,486 T107K probably damaging Het
Rsf1 A G 7: 97,680,773 T1169A possibly damaging Het
Ryr2 C A 13: 11,706,667 W2626L probably damaging Het
Scn4a C T 11: 106,323,962 V1270I probably damaging Het
Serpinb9b T C 13: 33,039,823 S333P probably damaging Het
Sned1 A G 1: 93,296,297 probably benign Het
Sult1c2 C T 17: 53,830,109 V262M possibly damaging Het
Tll1 A T 8: 64,051,377 F662I probably benign Het
Tmem161a A T 8: 70,180,947 probably null Het
Top1mt A C 15: 75,664,058 V465G possibly damaging Het
Trcg1 A G 9: 57,245,861 K596E possibly damaging Het
Trim27 T A 13: 21,180,916 probably null Het
Trpm3 A G 19: 22,987,388 I1406V possibly damaging Het
Tssc4 T A 7: 143,070,509 S254T probably damaging Het
Ttc7 C A 17: 87,370,735 probably benign Het
Usp30 A G 5: 114,119,644 T288A probably damaging Het
Usp48 C A 4: 137,616,381 R441S probably benign Het
Vmn1r29 T C 6: 58,307,300 S2P probably benign Het
Vmn2r65 T A 7: 84,963,874 I46L possibly damaging Het
Zeb1 A T 18: 5,766,775 I429F probably damaging Het
Zfp943 A G 17: 21,993,195 R421G probably benign Het
Other mutations in Fbxw11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01475:Fbxw11 APN 11 32722101 missense possibly damaging 0.94
IGL01828:Fbxw11 APN 11 32720505 missense probably damaging 1.00
PIT4651001:Fbxw11 UTSW 11 32711999 critical splice donor site probably null
R0311:Fbxw11 UTSW 11 32722083 missense probably benign 0.00
R0331:Fbxw11 UTSW 11 32711895 missense probably damaging 0.99
R0597:Fbxw11 UTSW 11 32720496 missense probably damaging 1.00
R0989:Fbxw11 UTSW 11 32735149 missense probably benign 0.17
R1175:Fbxw11 UTSW 11 32711922 missense probably damaging 0.96
R1327:Fbxw11 UTSW 11 32711859 missense probably benign 0.00
R1589:Fbxw11 UTSW 11 32733612 missense probably damaging 1.00
R3155:Fbxw11 UTSW 11 32739244 missense possibly damaging 0.93
R4084:Fbxw11 UTSW 11 32739248 missense probably damaging 1.00
R4610:Fbxw11 UTSW 11 32711859 missense possibly damaging 0.48
R4694:Fbxw11 UTSW 11 32642820 unclassified probably benign
R4946:Fbxw11 UTSW 11 32739226 missense probably damaging 1.00
R5027:Fbxw11 UTSW 11 32652811 intron probably benign
R5345:Fbxw11 UTSW 11 32738471 missense probably damaging 1.00
R5459:Fbxw11 UTSW 11 32739191 missense possibly damaging 0.85
R5802:Fbxw11 UTSW 11 32711790 missense probably benign 0.18
R5820:Fbxw11 UTSW 11 32735374 missense probably damaging 1.00
R6181:Fbxw11 UTSW 11 32742575 missense probably benign
R6365:Fbxw11 UTSW 11 32720623 missense possibly damaging 0.75
R6948:Fbxw11 UTSW 11 32742597 missense probably damaging 0.98
R7251:Fbxw11 UTSW 11 32731370 missense probably benign 0.00
R7475:Fbxw11 UTSW 11 32711999 critical splice donor site probably null
X0064:Fbxw11 UTSW 11 32711859 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCTCAGGGAAAGGATGCG -3'
(R):5'- CAGAAGTGAGCGAGGTCTTG -3'

Sequencing Primer
(F):5'- ACCACGCAGGAGGCATTG -3'
(R):5'- TCTTGAAGAGCCCAGGCAG -3'
Posted On2015-10-08