Incidental Mutation 'R0267:Olfr429'
ID34973
Institutional Source Beutler Lab
Gene Symbol Olfr429
Ensembl Gene ENSMUSG00000049528
Gene Nameolfactory receptor 429
SynonymsMOR105-1, GA_x6K02T2P20D-21090094-21089156
MMRRC Submission 038493-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R0267 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location174084331-174091343 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 174089166 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 42 (N42S)
Ref Sequence ENSEMBL: ENSMUSP00000149257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060693] [ENSMUST00000216346]
Predicted Effect probably damaging
Transcript: ENSMUST00000060693
AA Change: N42S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051323
Gene: ENSMUSG00000049528
AA Change: N42S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.2e-65 PFAM
Pfam:7tm_1 41 290 1.3e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000193320
AA Change: N42S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142323
Gene: ENSMUSG00000049528
AA Change: N42S

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
Pfam:7tm_1 41 290 8.9e-31 PFAM
Pfam:7tm_4 139 283 6.7e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216346
AA Change: N42S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.4853 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.7%
  • 10x: 96.2%
  • 20x: 94.0%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,046,105 F1721S probably damaging Het
Adgrb1 G A 15: 74,529,389 R78H probably damaging Het
Adgrd1 G A 5: 129,139,594 A342T probably benign Het
Adrb1 A T 19: 56,723,491 K374* probably null Het
Aldh18a1 C A 19: 40,573,789 V264F probably benign Het
Aldh1l2 C T 10: 83,522,687 probably benign Het
Alox15 T A 11: 70,346,153 H393L probably damaging Het
Aox2 A G 1: 58,339,446 probably benign Het
Appbp2 T C 11: 85,201,462 Y297C probably damaging Het
Atxn2l T G 7: 126,493,207 Q950P probably damaging Het
Bicd1 A T 6: 149,517,042 D737V probably damaging Het
C9 T C 15: 6,467,458 I212T probably benign Het
Ccdc63 A T 5: 122,117,044 probably benign Het
Chst1 C A 2: 92,613,606 P141Q probably damaging Het
Cped1 T A 6: 22,119,476 F311L probably damaging Het
D6Wsu163e T A 6: 126,946,491 H113Q probably benign Het
Dcn A T 10: 97,506,483 probably benign Het
Dmbx1 C T 4: 115,918,112 A324T probably benign Het
Dock10 G T 1: 80,512,454 Q1618K probably damaging Het
Dpyd A G 3: 118,917,272 E443G probably benign Het
Espl1 T C 15: 102,313,017 V953A possibly damaging Het
Exosc10 T C 4: 148,562,756 L174P probably damaging Het
Foxg1 A G 12: 49,385,582 Y366C probably damaging Het
Fxyd3 T C 7: 31,070,734 probably benign Het
Gbp2 T C 3: 142,630,106 V189A probably benign Het
Gins4 T C 8: 23,229,410 probably benign Het
Gm12789 A G 4: 101,988,122 T3A probably benign Het
Gnb1l T C 16: 18,548,089 probably benign Het
Gtpbp3 T C 8: 71,491,497 L295S probably damaging Het
Hrh4 C A 18: 13,022,398 Y331* probably null Het
Hsd11b1 A T 1: 193,241,397 Y52N probably damaging Het
Jam3 A G 9: 27,106,405 I29T probably benign Het
Kctd16 T A 18: 40,530,877 I353N probably benign Het
Lama4 G T 10: 39,028,639 G246C probably damaging Het
Lhx3 T A 2: 26,203,028 M137L probably benign Het
Morc2a T C 11: 3,678,567 I340T probably benign Het
Myo7a A C 7: 98,054,624 I1969S probably benign Het
Olfr1471 T A 19: 13,445,428 C139S probably damaging Het
Olfr304 T C 7: 86,386,267 E131G possibly damaging Het
Pclo T C 5: 14,681,180 L3232P unknown Het
Polr1a T G 6: 71,974,139 I1407M probably damaging Het
Ppip5k2 A G 1: 97,728,997 V817A probably damaging Het
Rbfox3 T C 11: 118,495,240 T280A probably benign Het
Rfx3 T C 19: 27,793,788 D521G probably benign Het
Scn5a C T 9: 119,543,135 V223I probably damaging Het
Sgsm3 T G 15: 81,006,602 M119R probably damaging Het
Slc6a7 T A 18: 60,996,711 M608L probably benign Het
Slit2 A G 5: 48,182,331 probably benign Het
Steap2 T A 5: 5,673,561 I440F probably benign Het
Syn2 T G 6: 115,254,150 probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tfb2m G A 1: 179,533,638 H262Y probably benign Het
Trmt1l A G 1: 151,457,675 probably benign Het
Trpm6 C A 19: 18,823,378 P819T probably benign Het
Ttn G A 2: 76,743,689 A25620V probably damaging Het
Ubn2 T C 6: 38,482,618 probably null Het
Vars T C 17: 35,011,596 probably benign Het
Vip A T 10: 5,644,004 D119V possibly damaging Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Vps33b T C 7: 80,286,054 I405T possibly damaging Het
Zbtb21 T A 16: 97,952,100 S356C probably damaging Het
Zdhhc6 A T 19: 55,308,930 S237T probably benign Het
Zfp142 G A 1: 74,576,064 A427V probably benign Het
Zfp692 T A 11: 58,314,314 V463E possibly damaging Het
Zmynd8 A T 2: 165,828,402 I384N probably damaging Het
Other mutations in Olfr429
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:Olfr429 APN 1 174089556 missense probably damaging 1.00
IGL01868:Olfr429 APN 1 174089370 missense possibly damaging 0.83
IGL01972:Olfr429 APN 1 174089421 missense probably damaging 0.99
IGL02412:Olfr429 APN 1 174089243 missense probably benign 0.00
IGL02628:Olfr429 APN 1 174089190 missense probably benign
IGL02861:Olfr429 APN 1 174089036 utr 5 prime probably benign
IGL03404:Olfr429 APN 1 174089898 missense probably damaging 1.00
R0357:Olfr429 UTSW 1 174089109 missense possibly damaging 0.71
R1499:Olfr429 UTSW 1 174089247 nonsense probably null
R2051:Olfr429 UTSW 1 174089219 missense possibly damaging 0.95
R4706:Olfr429 UTSW 1 174089702 missense probably damaging 1.00
R4820:Olfr429 UTSW 1 174089176 missense possibly damaging 0.95
R5439:Olfr429 UTSW 1 174089975 missense probably benign 0.01
R5538:Olfr429 UTSW 1 174089978 makesense probably null
R5907:Olfr429 UTSW 1 174089219 missense probably benign 0.08
R6932:Olfr429 UTSW 1 174089750 missense probably damaging 0.96
R7808:Olfr429 UTSW 1 174089851 nonsense probably null
R8040:Olfr429 UTSW 1 174089157 missense possibly damaging 0.68
R8467:Olfr429 UTSW 1 174089441 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCTTGATTGGATGCCAATGGCTAC -3'
(R):5'- GGCCTGCAAATGGCTAAGTACCTG -3'

Sequencing Primer
(F):5'- GGATGCCAATGGCTACTTTCTC -3'
(R):5'- GGTAGCACTCAGTAGCTCCAAG -3'
Posted On2013-05-09