Incidental Mutation 'R0267:Hsd11b1'
ID34975
Institutional Source Beutler Lab
Gene Symbol Hsd11b1
Ensembl Gene ENSMUSG00000016194
Gene Namehydroxysteroid 11-beta dehydrogenase 1
Synonyms11beta-hydroxysteroid dehydrogenase type 1, 11beta-HSD-1
MMRRC Submission 038493-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R0267 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location193221634-193264075 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 193241397 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 52 (Y52N)
Ref Sequence ENSEMBL: ENSMUSP00000125620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016338] [ENSMUST00000159644] [ENSMUST00000160929] [ENSMUST00000161737] [ENSMUST00000192322] [ENSMUST00000194677]
Predicted Effect probably damaging
Transcript: ENSMUST00000016338
AA Change: Y52N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000016338
Gene: ENSMUSG00000016194
AA Change: Y52N

DomainStartEndE-ValueType
Pfam:adh_short 35 230 1.1e-53 PFAM
Pfam:KR 36 215 2.4e-9 PFAM
Pfam:adh_short_C2 41 248 3.8e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159644
AA Change: Y52N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124693
Gene: ENSMUSG00000016194
AA Change: Y52N

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:adh_short 47 214 2.1e-32 PFAM
Pfam:KR 48 223 1.6e-10 PFAM
Pfam:adh_short_C2 53 221 4.5e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160929
AA Change: Y22N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123849
Gene: ENSMUSG00000016194
AA Change: Y22N

DomainStartEndE-ValueType
Pfam:adh_short 5 172 1.5e-32 PFAM
Pfam:KR 6 184 8.2e-11 PFAM
Pfam:adh_short_C2 11 218 1.6e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161406
SMART Domains Protein: ENSMUSP00000124142
Gene: ENSMUSG00000016194

DomainStartEndE-ValueType
Pfam:adh_short 1 72 1.2e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161737
AA Change: Y52N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125620
Gene: ENSMUSG00000016194
AA Change: Y52N

DomainStartEndE-ValueType
Pfam:adh_short 35 202 2.6e-32 PFAM
Pfam:KR 36 216 1.7e-10 PFAM
Pfam:adh_short_C2 41 248 3.2e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162842
SMART Domains Protein: ENSMUSP00000124715
Gene: ENSMUSG00000016194

DomainStartEndE-ValueType
Pfam:adh_short 1 132 4.4e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191977
Predicted Effect probably benign
Transcript: ENSMUST00000192322
SMART Domains Protein: ENSMUSP00000141302
Gene: ENSMUSG00000026639

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LamNT 20 244 2.9e-80 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194677
SMART Domains Protein: ENSMUSP00000142053
Gene: ENSMUSG00000026639

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LamNT 20 248 7.63e-84 SMART
EGF_Lam 250 310 1.67e-7 SMART
EGF_Lam 313 373 1.14e-9 SMART
EGF_Lam 376 425 5.56e-13 SMART
EGF_Lam 428 475 6.05e-14 SMART
EGF_Lam 478 528 5e-6 SMART
EGF_Lam 531 575 3.01e-9 SMART
low complexity region 662 673 N/A INTRINSIC
low complexity region 727 763 N/A INTRINSIC
coiled coil region 830 879 N/A INTRINSIC
coiled coil region 949 979 N/A INTRINSIC
coiled coil region 1037 1090 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Meta Mutation Damage Score 0.5609 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.7%
  • 10x: 96.2%
  • 20x: 94.0%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a microsomal enzyme that catalyzes the conversion of the stress hormone cortisol to the inactive metabolite cortisone. In addition, the encoded protein can catalyze the reverse reaction, the conversion of cortisone to cortisol. Too much cortisol can lead to central obesity, and a particular variation in this gene has been associated with obesity and insulin resistance in children. Mutations in this gene and H6PD (hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)) are the cause of cortisone reductase deficiency. Alternate splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display improved glucose tolerance and lower circulating lipid levels. Mice homozygous for a different targeted allele exhibit decreased susceptibility to weight gain, adiposis or hyperinsulinemia induced by 11-DHC. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,046,105 F1721S probably damaging Het
Adgrb1 G A 15: 74,529,389 R78H probably damaging Het
Adgrd1 G A 5: 129,139,594 A342T probably benign Het
Adrb1 A T 19: 56,723,491 K374* probably null Het
Aldh18a1 C A 19: 40,573,789 V264F probably benign Het
Aldh1l2 C T 10: 83,522,687 probably benign Het
Alox15 T A 11: 70,346,153 H393L probably damaging Het
Aox2 A G 1: 58,339,446 probably benign Het
Appbp2 T C 11: 85,201,462 Y297C probably damaging Het
Atxn2l T G 7: 126,493,207 Q950P probably damaging Het
Bicd1 A T 6: 149,517,042 D737V probably damaging Het
C9 T C 15: 6,467,458 I212T probably benign Het
Ccdc63 A T 5: 122,117,044 probably benign Het
Chst1 C A 2: 92,613,606 P141Q probably damaging Het
Cped1 T A 6: 22,119,476 F311L probably damaging Het
D6Wsu163e T A 6: 126,946,491 H113Q probably benign Het
Dcn A T 10: 97,506,483 probably benign Het
Dmbx1 C T 4: 115,918,112 A324T probably benign Het
Dock10 G T 1: 80,512,454 Q1618K probably damaging Het
Dpyd A G 3: 118,917,272 E443G probably benign Het
Espl1 T C 15: 102,313,017 V953A possibly damaging Het
Exosc10 T C 4: 148,562,756 L174P probably damaging Het
Foxg1 A G 12: 49,385,582 Y366C probably damaging Het
Fxyd3 T C 7: 31,070,734 probably benign Het
Gbp2 T C 3: 142,630,106 V189A probably benign Het
Gins4 T C 8: 23,229,410 probably benign Het
Gm12789 A G 4: 101,988,122 T3A probably benign Het
Gnb1l T C 16: 18,548,089 probably benign Het
Gtpbp3 T C 8: 71,491,497 L295S probably damaging Het
Hrh4 C A 18: 13,022,398 Y331* probably null Het
Jam3 A G 9: 27,106,405 I29T probably benign Het
Kctd16 T A 18: 40,530,877 I353N probably benign Het
Lama4 G T 10: 39,028,639 G246C probably damaging Het
Lhx3 T A 2: 26,203,028 M137L probably benign Het
Morc2a T C 11: 3,678,567 I340T probably benign Het
Myo7a A C 7: 98,054,624 I1969S probably benign Het
Olfr1471 T A 19: 13,445,428 C139S probably damaging Het
Olfr304 T C 7: 86,386,267 E131G possibly damaging Het
Olfr429 A G 1: 174,089,166 N42S probably damaging Het
Pclo T C 5: 14,681,180 L3232P unknown Het
Polr1a T G 6: 71,974,139 I1407M probably damaging Het
Ppip5k2 A G 1: 97,728,997 V817A probably damaging Het
Rbfox3 T C 11: 118,495,240 T280A probably benign Het
Rfx3 T C 19: 27,793,788 D521G probably benign Het
Scn5a C T 9: 119,543,135 V223I probably damaging Het
Sgsm3 T G 15: 81,006,602 M119R probably damaging Het
Slc6a7 T A 18: 60,996,711 M608L probably benign Het
Slit2 A G 5: 48,182,331 probably benign Het
Steap2 T A 5: 5,673,561 I440F probably benign Het
Syn2 T G 6: 115,254,150 probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tfb2m G A 1: 179,533,638 H262Y probably benign Het
Trmt1l A G 1: 151,457,675 probably benign Het
Trpm6 C A 19: 18,823,378 P819T probably benign Het
Ttn G A 2: 76,743,689 A25620V probably damaging Het
Ubn2 T C 6: 38,482,618 probably null Het
Vars T C 17: 35,011,596 probably benign Het
Vip A T 10: 5,644,004 D119V possibly damaging Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Vps33b T C 7: 80,286,054 I405T possibly damaging Het
Zbtb21 T A 16: 97,952,100 S356C probably damaging Het
Zdhhc6 A T 19: 55,308,930 S237T probably benign Het
Zfp142 G A 1: 74,576,064 A427V probably benign Het
Zfp692 T A 11: 58,314,314 V463E possibly damaging Het
Zmynd8 A T 2: 165,828,402 I384N probably damaging Het
Other mutations in Hsd11b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Hsd11b1 APN 1 193241458 start codon destroyed probably null 0.43
IGL00969:Hsd11b1 APN 1 193223644 nonsense probably null
IGL02068:Hsd11b1 APN 1 193222046 nonsense probably null
IGL02331:Hsd11b1 APN 1 193240616 missense probably damaging 1.00
H8786:Hsd11b1 UTSW 1 193240252 missense probably benign 0.30
R0207:Hsd11b1 UTSW 1 193240248 missense probably damaging 1.00
R0334:Hsd11b1 UTSW 1 193242168 intron probably benign
R0591:Hsd11b1 UTSW 1 193229676 intron probably benign
R1244:Hsd11b1 UTSW 1 193223760 missense probably benign 0.02
R1569:Hsd11b1 UTSW 1 193240327 missense probably damaging 0.99
R1570:Hsd11b1 UTSW 1 193240327 missense probably damaging 0.99
R1892:Hsd11b1 UTSW 1 193223760 missense probably benign 0.02
R2021:Hsd11b1 UTSW 1 193240378 missense probably benign 0.00
R2022:Hsd11b1 UTSW 1 193240378 missense probably benign 0.00
R2023:Hsd11b1 UTSW 1 193240378 missense probably benign 0.00
R5061:Hsd11b1 UTSW 1 193242245 missense probably benign
R5531:Hsd11b1 UTSW 1 193240249 frame shift probably null
R5768:Hsd11b1 UTSW 1 193240246 missense probably damaging 0.99
R5793:Hsd11b1 UTSW 1 193242184 missense probably damaging 1.00
R5795:Hsd11b1 UTSW 1 193240632 missense possibly damaging 0.85
R6359:Hsd11b1 UTSW 1 193242352 intron probably benign
R8440:Hsd11b1 UTSW 1 193222112 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGAGCAGATACAGGAACCCCAGTC -3'
(R):5'- AACCGCAAGTGCAGCTTCAGTG -3'

Sequencing Primer
(F):5'- ACATGTATCTGCACAAGGGC -3'
(R):5'- GCAGCTTCAGTGGTTACAGC -3'
Posted On2013-05-09