Incidental Mutation 'R0267:Lhx3'
ID34976
Institutional Source Beutler Lab
Gene Symbol Lhx3
Ensembl Gene ENSMUSG00000026934
Gene NameLIM homeobox protein 3
SynonymsmLim-3, Lim3, P-LIM
MMRRC Submission 038493-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0267 (G1)
Quality Score186
Status Validated
Chromosome2
Chromosomal Location26200212-26208289 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 26203028 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 137 (M137L)
Ref Sequence ENSEMBL: ENSMUSP00000056822 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028302] [ENSMUST00000054099]
PDB Structure
NMR Solution Structure of a ldb1-LID:Lhx3-LIM complex [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000028302
AA Change: M139L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000028302
Gene: ENSMUSG00000026934
AA Change: M139L

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
LIM 35 86 4.18e-17 SMART
LIM 94 149 7.8e-17 SMART
HOX 162 224 7.13e-23 SMART
low complexity region 237 249 N/A INTRINSIC
low complexity region 323 342 N/A INTRINSIC
low complexity region 353 362 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000054099
AA Change: M137L

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000056822
Gene: ENSMUSG00000026934
AA Change: M137L

DomainStartEndE-ValueType
LIM 33 84 4.18e-17 SMART
LIM 92 147 7.8e-17 SMART
HOX 160 222 7.13e-23 SMART
low complexity region 235 247 N/A INTRINSIC
low complexity region 321 340 N/A INTRINSIC
low complexity region 351 360 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127035
SMART Domains Protein: ENSMUSP00000134884
Gene: ENSMUSG00000026934

DomainStartEndE-ValueType
Pfam:Homeobox 1 17 6.2e-5 PFAM
low complexity region 35 47 N/A INTRINSIC
low complexity region 121 140 N/A INTRINSIC
low complexity region 151 160 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149637
SMART Domains Protein: ENSMUSP00000135765
Gene: ENSMUSG00000026934

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 22 38 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184787
Meta Mutation Damage Score 0.0639 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.7%
  • 10x: 96.2%
  • 20x: 94.0%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a large family of proteins which carry the LIM domain, a unique cysteine-rich zinc-binding domain. The encoded protein is a transcription factor that is required for pituitary development and motor neuron specification. Mutations in this gene cause combined pituitary hormone deficiency 3. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit failure of growth and differentiation of Rathke's pouch, lack both anterior and intermediate lobes of the pituitary gland, and die perinatally, within 24 hours of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,046,105 F1721S probably damaging Het
Adgrb1 G A 15: 74,529,389 R78H probably damaging Het
Adgrd1 G A 5: 129,139,594 A342T probably benign Het
Adrb1 A T 19: 56,723,491 K374* probably null Het
Aldh18a1 C A 19: 40,573,789 V264F probably benign Het
Aldh1l2 C T 10: 83,522,687 probably benign Het
Alox15 T A 11: 70,346,153 H393L probably damaging Het
Aox2 A G 1: 58,339,446 probably benign Het
Appbp2 T C 11: 85,201,462 Y297C probably damaging Het
Atxn2l T G 7: 126,493,207 Q950P probably damaging Het
Bicd1 A T 6: 149,517,042 D737V probably damaging Het
C9 T C 15: 6,467,458 I212T probably benign Het
Ccdc63 A T 5: 122,117,044 probably benign Het
Chst1 C A 2: 92,613,606 P141Q probably damaging Het
Cped1 T A 6: 22,119,476 F311L probably damaging Het
D6Wsu163e T A 6: 126,946,491 H113Q probably benign Het
Dcn A T 10: 97,506,483 probably benign Het
Dmbx1 C T 4: 115,918,112 A324T probably benign Het
Dock10 G T 1: 80,512,454 Q1618K probably damaging Het
Dpyd A G 3: 118,917,272 E443G probably benign Het
Espl1 T C 15: 102,313,017 V953A possibly damaging Het
Exosc10 T C 4: 148,562,756 L174P probably damaging Het
Foxg1 A G 12: 49,385,582 Y366C probably damaging Het
Fxyd3 T C 7: 31,070,734 probably benign Het
Gbp2 T C 3: 142,630,106 V189A probably benign Het
Gins4 T C 8: 23,229,410 probably benign Het
Gm12789 A G 4: 101,988,122 T3A probably benign Het
Gnb1l T C 16: 18,548,089 probably benign Het
Gtpbp3 T C 8: 71,491,497 L295S probably damaging Het
Hrh4 C A 18: 13,022,398 Y331* probably null Het
Hsd11b1 A T 1: 193,241,397 Y52N probably damaging Het
Jam3 A G 9: 27,106,405 I29T probably benign Het
Kctd16 T A 18: 40,530,877 I353N probably benign Het
Lama4 G T 10: 39,028,639 G246C probably damaging Het
Morc2a T C 11: 3,678,567 I340T probably benign Het
Myo7a A C 7: 98,054,624 I1969S probably benign Het
Olfr1471 T A 19: 13,445,428 C139S probably damaging Het
Olfr304 T C 7: 86,386,267 E131G possibly damaging Het
Olfr429 A G 1: 174,089,166 N42S probably damaging Het
Pclo T C 5: 14,681,180 L3232P unknown Het
Polr1a T G 6: 71,974,139 I1407M probably damaging Het
Ppip5k2 A G 1: 97,728,997 V817A probably damaging Het
Rbfox3 T C 11: 118,495,240 T280A probably benign Het
Rfx3 T C 19: 27,793,788 D521G probably benign Het
Scn5a C T 9: 119,543,135 V223I probably damaging Het
Sgsm3 T G 15: 81,006,602 M119R probably damaging Het
Slc6a7 T A 18: 60,996,711 M608L probably benign Het
Slit2 A G 5: 48,182,331 probably benign Het
Steap2 T A 5: 5,673,561 I440F probably benign Het
Syn2 T G 6: 115,254,150 probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tfb2m G A 1: 179,533,638 H262Y probably benign Het
Trmt1l A G 1: 151,457,675 probably benign Het
Trpm6 C A 19: 18,823,378 P819T probably benign Het
Ttn G A 2: 76,743,689 A25620V probably damaging Het
Ubn2 T C 6: 38,482,618 probably null Het
Vars T C 17: 35,011,596 probably benign Het
Vip A T 10: 5,644,004 D119V possibly damaging Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Vps33b T C 7: 80,286,054 I405T possibly damaging Het
Zbtb21 T A 16: 97,952,100 S356C probably damaging Het
Zdhhc6 A T 19: 55,308,930 S237T probably benign Het
Zfp142 G A 1: 74,576,064 A427V probably benign Het
Zfp692 T A 11: 58,314,314 V463E possibly damaging Het
Zmynd8 A T 2: 165,828,402 I384N probably damaging Het
Other mutations in Lhx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02309:Lhx3 APN 2 26201373 missense probably benign
IGL02691:Lhx3 APN 2 26203085 missense probably damaging 1.00
R0571:Lhx3 UTSW 2 26201124 missense probably damaging 1.00
R0574:Lhx3 UTSW 2 26201311 missense probably benign 0.00
R1866:Lhx3 UTSW 2 26203974 missense probably damaging 0.99
R1926:Lhx3 UTSW 2 26202188 nonsense probably null
R1940:Lhx3 UTSW 2 26203962 missense probably benign 0.05
R3147:Lhx3 UTSW 2 26201265 missense probably benign 0.01
R4389:Lhx3 UTSW 2 26201090 utr 3 prime probably benign
R4534:Lhx3 UTSW 2 26204014 missense probably benign
R4551:Lhx3 UTSW 2 26201190 missense probably damaging 1.00
R4761:Lhx3 UTSW 2 26201423 frame shift probably null
R5102:Lhx3 UTSW 2 26201423 frame shift probably null
R5105:Lhx3 UTSW 2 26201423 frame shift probably null
R5431:Lhx3 UTSW 2 26201118 missense probably damaging 1.00
R5673:Lhx3 UTSW 2 26202994 missense probably damaging 1.00
R5751:Lhx3 UTSW 2 26201161 missense probably benign
R6180:Lhx3 UTSW 2 26201491 missense probably benign
R6262:Lhx3 UTSW 2 26202423 small deletion probably benign
R7238:Lhx3 UTSW 2 26202997 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCCGCCGATGTGACTGCTACTG -3'
(R):5'- TTGCTACCCAAGGTACTGTGGCTC -3'

Sequencing Primer
(F):5'- CTCCCCAGAGCAGTCTGTC -3'
(R):5'- GCTGATGGAGTCTTCCTGACC -3'
Posted On2013-05-09