Incidental Mutation 'R4678:Dlg2'
ID349763
Institutional Source Beutler Lab
Gene Symbol Dlg2
Ensembl Gene ENSMUSG00000052572
Gene Namediscs large MAGUK scaffold protein 2
SynonymsDlgh2, A330103J02Rik, Chapsyn-110, PSD93, B330007M19Rik, LOC382816, B230218P12Rik
MMRRC Submission 041931-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4678 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location90476672-92449247 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92428580 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 685 (I685V)
Ref Sequence ENSEMBL: ENSMUSP00000073885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074273] [ENSMUST00000098308] [ENSMUST00000107193] [ENSMUST00000107196] [ENSMUST00000231777]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074273
AA Change: I685V

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000073885
Gene: ENSMUSG00000052572
AA Change: I685V

DomainStartEndE-ValueType
MAGUK_N_PEST 14 97 1.5e-47 SMART
PDZ 106 185 1.15e-23 SMART
PDZ 201 280 9.86e-23 SMART
PDZ 429 502 1.77e-24 SMART
low complexity region 523 530 N/A INTRINSIC
SH3 539 605 7.82e-10 SMART
low complexity region 631 644 N/A INTRINSIC
GuKc 679 858 2.6e-73 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098308
AA Change: I296V

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000095910
Gene: ENSMUSG00000052572
AA Change: I296V

DomainStartEndE-ValueType
PDZ 26 99 1.77e-24 SMART
low complexity region 120 127 N/A INTRINSIC
SH3 136 202 7.82e-10 SMART
low complexity region 228 241 N/A INTRINSIC
GuKc 290 469 2.6e-73 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107193
AA Change: I570V

PolyPhen 2 Score 0.549 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102811
Gene: ENSMUSG00000052572
AA Change: I570V

DomainStartEndE-ValueType
low complexity region 45 57 N/A INTRINSIC
PDZ 61 140 1.15e-23 SMART
PDZ 156 235 9.86e-23 SMART
PDZ 332 405 1.77e-24 SMART
low complexity region 426 433 N/A INTRINSIC
SH3 442 508 7.82e-10 SMART
GuKc 564 743 2.6e-73 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107196
AA Change: I667V

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000102814
Gene: ENSMUSG00000052572
AA Change: I667V

DomainStartEndE-ValueType
MAGUK_N_PEST 14 97 1.5e-47 SMART
PDZ 106 185 1.15e-23 SMART
PDZ 201 280 9.86e-23 SMART
PDZ 429 502 1.77e-24 SMART
low complexity region 523 530 N/A INTRINSIC
SH3 539 605 7.82e-10 SMART
GuKc 661 840 2.6e-73 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135581
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138389
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207187
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208377
Predicted Effect probably benign
Transcript: ENSMUST00000231777
AA Change: I772V

PolyPhen 2 Score 0.322 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-associated guanylate kinase (MAGUK) family. The encoded protein forms a heterodimer with a related family member that may interact at postsynaptic sites to form a multimeric scaffold for the clustering of receptors, ion channels, and associated signaling proteins. Multiple transcript variants encoding different isoforms have been found for this gene. Additional transcript variants have been described, but their full-length nature is not known. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display lower surface expression of NMDA receptor (NMDAR) subunits NR2A and NR2B in dorsal horn neurons and significantly reduced NMDAR-mediated excitatory synaptic currents and NMDAR-dependent persistent inflammatory or nerve injury-induced neuropathic pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110025L11Rik T C 16: 89,063,985 probably benign Het
Abcc4 A G 14: 118,627,691 S308P probably damaging Het
Agr3 G T 12: 35,947,833 V115L probably damaging Het
Ahr A T 12: 35,507,464 I319N probably damaging Het
Alpk1 A T 3: 127,679,858 V832D probably damaging Het
Ano1 T C 7: 144,669,552 T78A probably benign Het
Apob G A 12: 7,995,585 G897D probably damaging Het
Arfgef1 A G 1: 10,142,666 F1677L probably benign Het
Arhgap40 G T 2: 158,532,306 G217W probably benign Het
Arhgef4 A G 1: 34,722,668 E335G unknown Het
Calcoco2 T C 11: 96,103,548 T60A probably damaging Het
Catsperg1 A T 7: 29,190,296 S741T probably benign Het
Ccdc181 T G 1: 164,278,277 I27S probably damaging Het
Ceacam9 A T 7: 16,725,409 Y211F probably damaging Het
Cep41 T C 6: 30,671,319 probably null Het
Cercam T A 2: 29,869,677 L45Q probably damaging Het
Cnnm2 G A 19: 46,763,246 V492M possibly damaging Het
Cntn3 A G 6: 102,204,020 V738A probably damaging Het
Coq8a T C 1: 180,170,081 E351G probably damaging Het
Cyp3a57 T C 5: 145,370,728 probably null Het
Dbn1 T C 13: 55,475,258 I471V probably benign Het
Ddx21 G T 10: 62,594,003 Q321K probably benign Het
Dhx8 T C 11: 101,739,808 V347A probably damaging Het
Dkc1 A G X: 75,100,992 I215V probably benign Homo
Dusp11 A C 6: 85,953,381 N140K probably damaging Het
Ece2 A G 16: 20,640,718 K454R probably damaging Het
Eno4 T A 19: 58,946,749 V131E probably damaging Het
Enpep A G 3: 129,303,713 probably null Het
Etv1 T C 12: 38,835,220 Y236H probably damaging Het
F2rl2 A G 13: 95,700,632 T62A probably benign Het
Fam196b T G 11: 34,403,227 L423R probably damaging Het
Fbxl21 T C 13: 56,537,049 V296A probably damaging Het
Fig4 T C 10: 41,272,998 I153V probably benign Het
Fis1 T A 5: 136,963,097 N41K possibly damaging Het
Fras1 T A 5: 96,700,568 M1814K probably benign Het
Frem2 T A 3: 53,544,371 I2266F probably benign Het
Gm10330 A T 12: 23,779,842 *113R probably null Het
Gm12185 T A 11: 48,915,540 I275F probably benign Het
Gsdme A T 6: 50,229,324 C180S possibly damaging Het
Herc1 A G 9: 66,416,269 E1355G probably benign Het
Hnrnpm A T 17: 33,650,211 I453N possibly damaging Het
Hspb9 T C 11: 100,714,070 L74P probably damaging Het
Ift46 C A 9: 44,783,963 Y85* probably null Het
Ints3 T C 3: 90,408,510 T316A possibly damaging Het
Isg20 C T 7: 78,914,328 probably benign Het
Itga11 T A 9: 62,735,357 N187K probably damaging Het
Klhl9 G A 4: 88,720,924 T360I probably damaging Het
Krt39 T A 11: 99,521,000 I87F probably benign Het
Krtap19-4 G A 16: 88,884,846 S74F unknown Het
Lgi1 G A 19: 38,301,289 V268I probably damaging Het
Lrrc46 G A 11: 97,034,893 P248S probably benign Het
Lrrn4 C T 2: 132,879,568 V110I probably benign Het
Mamstr C A 7: 45,644,692 probably benign Het
Micu3 T A 8: 40,380,677 F451I probably damaging Het
Mid1 C A X: 169,985,048 D130E possibly damaging Het
Mkks T C 2: 136,880,281 T319A probably benign Het
Mob3c A G 4: 115,833,771 probably null Het
Muc6 T C 7: 141,644,287 E1192G probably benign Het
Ndc80 A G 17: 71,520,758 probably null Het
Nfx1 A G 4: 41,012,070 K807E probably benign Het
Nrxn1 A T 17: 90,623,422 L181Q probably damaging Het
Nsun7 A G 5: 66,261,064 S46G probably benign Het
Nup98 A T 7: 102,184,831 L308H probably damaging Het
Olfr1079 T C 2: 86,538,733 M61V possibly damaging Het
Olfr1220 C A 2: 89,097,516 W137L probably benign Het
Olfr523 T C 7: 140,176,228 V36A probably benign Het
Olfr592 T C 7: 103,186,891 F97L probably damaging Het
Palb2 T C 7: 122,127,366 K427R probably damaging Het
Pcdha1 C A 18: 36,930,912 Q210K probably benign Het
Pcdhb2 T C 18: 37,296,207 L411P probably damaging Het
Pde4dip C A 3: 97,695,005 D2252Y probably damaging Het
Plekhg4 T A 8: 105,380,371 Y899* probably null Het
Plxnb2 G T 15: 89,160,928 T1105K probably benign Het
Psmd2 T C 16: 20,659,969 V606A probably damaging Het
Ptprq A T 10: 107,685,182 F710I probably benign Het
Rad51ap2 A G 12: 11,456,551 E158G probably damaging Het
Rasip1 T A 7: 45,627,823 H18Q possibly damaging Het
Rassf8 A G 6: 145,815,082 K45E probably damaging Het
Rrn3 T A 16: 13,796,076 M284K probably damaging Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Het
Rtn2 C A 7: 19,293,895 N403K probably damaging Het
Rusc1 A G 3: 89,089,720 W462R probably damaging Het
Sdc3 T A 4: 130,818,596 probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc12a2 T A 18: 57,905,960 C537* probably null Het
Slc4a2 G A 5: 24,434,240 probably null Het
Spsb4 T A 9: 96,995,691 D193V probably damaging Het
Strn A C 17: 78,677,351 F288V probably damaging Het
Stx18 G A 5: 38,136,368 probably benign Het
Tfcp2l1 T A 1: 118,668,648 M371K probably benign Het
Thnsl1 A G 2: 21,211,541 probably null Het
Tlr11 C T 14: 50,360,982 H142Y possibly damaging Het
Tor1aip2 T A 1: 156,065,034 I362K probably damaging Het
Trmt13 T C 3: 116,589,755 K125E probably damaging Het
Trpm8 T C 1: 88,337,129 V320A probably benign Het
Ubr3 A T 2: 69,935,919 H377L probably damaging Het
Usp8 A G 2: 126,725,429 R123G probably null Het
Vim T A 2: 13,574,964 L178Q probably damaging Het
Vmn1r231 A C 17: 20,890,227 V142G possibly damaging Het
Vmn1r83 A G 7: 12,321,770 M120T possibly damaging Het
Vwce G T 19: 10,664,648 V913F possibly damaging Het
Zbtb18 C A 1: 177,447,719 T215K probably benign Het
Zeb2 A T 2: 44,996,341 D857E probably damaging Het
Zfp106 G A 2: 120,533,740 H729Y probably damaging Het
Zfp977 C A 7: 42,580,013 A363S probably benign Het
Other mutations in Dlg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Dlg2 APN 7 91965645 missense probably damaging 1.00
IGL01111:Dlg2 APN 7 91449763 missense possibly damaging 0.84
IGL01122:Dlg2 APN 7 92442608 missense possibly damaging 0.58
IGL01296:Dlg2 APN 7 91940059 missense probably damaging 1.00
IGL02063:Dlg2 APN 7 91810476 splice site probably benign
IGL02233:Dlg2 APN 7 92444538 missense probably damaging 1.00
IGL02519:Dlg2 APN 7 91940115 missense possibly damaging 0.54
IGL02833:Dlg2 APN 7 92431127 missense probably damaging 1.00
IGL03166:Dlg2 APN 7 91900730 splice site probably benign
R0932:Dlg2 UTSW 7 92375637 missense probably damaging 1.00
R1129:Dlg2 UTSW 7 92431174 splice site probably null
R1245:Dlg2 UTSW 7 92442595 splice site probably benign
R1319:Dlg2 UTSW 7 92438023 missense probably damaging 0.98
R1464:Dlg2 UTSW 7 91968198 missense probably damaging 1.00
R1464:Dlg2 UTSW 7 91968198 missense probably damaging 1.00
R1596:Dlg2 UTSW 7 92431051 missense probably damaging 0.99
R1650:Dlg2 UTSW 7 92431051 missense probably damaging 0.99
R1868:Dlg2 UTSW 7 92386952 nonsense probably null
R2006:Dlg2 UTSW 7 91965617 missense possibly damaging 0.95
R2026:Dlg2 UTSW 7 91965723 missense probably damaging 1.00
R2281:Dlg2 UTSW 7 92438041 missense probably damaging 1.00
R3721:Dlg2 UTSW 7 91711800 critical splice donor site probably null
R3722:Dlg2 UTSW 7 91711800 critical splice donor site probably null
R3793:Dlg2 UTSW 7 91810535 splice site probably benign
R4120:Dlg2 UTSW 7 91965638 missense probably damaging 1.00
R4444:Dlg2 UTSW 7 92088593 missense probably damaging 1.00
R4631:Dlg2 UTSW 7 92088614 missense probably damaging 1.00
R4672:Dlg2 UTSW 7 92286535 missense probably damaging 1.00
R4695:Dlg2 UTSW 7 92437962 splice site probably null
R5106:Dlg2 UTSW 7 92442686 missense probably damaging 0.99
R5355:Dlg2 UTSW 7 91449803 missense probably benign 0.41
R5385:Dlg2 UTSW 7 92088576 missense probably damaging 0.96
R5403:Dlg2 UTSW 7 92431002 missense probably damaging 1.00
R5504:Dlg2 UTSW 7 92442657 missense probably damaging 1.00
R5569:Dlg2 UTSW 7 91968180 missense probably benign 0.01
R5573:Dlg2 UTSW 7 91997324 splice site probably null
R5848:Dlg2 UTSW 7 92444527 missense probably benign 0.41
R5863:Dlg2 UTSW 7 91711779 missense probably benign 0.01
R5907:Dlg2 UTSW 7 91997371 intron probably benign
R6455:Dlg2 UTSW 7 92444508 splice site probably null
R6486:Dlg2 UTSW 7 91872374 critical splice acceptor site probably null
R6817:Dlg2 UTSW 7 91965664 missense probably benign 0.07
R7082:Dlg2 UTSW 7 90731984 missense probably benign
R7808:Dlg2 UTSW 7 92431055 missense probably benign 0.01
R7818:Dlg2 UTSW 7 91940017 missense probably damaging 0.99
R7908:Dlg2 UTSW 7 91900773 missense probably damaging 1.00
R7989:Dlg2 UTSW 7 91900773 missense probably damaging 1.00
RF004:Dlg2 UTSW 7 90852677 missense probably benign
Predicted Primers PCR Primer
(F):5'- CATGCTGAGGGCTAAACATGC -3'
(R):5'- TGACATGCGAATCACACCAG -3'

Sequencing Primer
(F):5'- GCTGAGGGCTAAACATGCATTTC -3'
(R):5'- TGCGAATCACACCAGAGATTCTTCTC -3'
Posted On2015-10-08