Incidental Mutation 'R4678:Rsf1'
ID 349764
Institutional Source Beutler Lab
Gene Symbol Rsf1
Ensembl Gene ENSMUSG00000035623
Gene Name remodeling and spacing factor 1
Synonyms 4832420A03Rik, Hbxap, C030033M12Rik, XAP8, p325
MMRRC Submission 041931-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4678 (G1)
Quality Score 214
Status Not validated
Chromosome 7
Chromosomal Location 97229103-97341989 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) GGCG to GGCGACGGCTGCG at 97229113 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042627] [ENSMUST00000072725] [ENSMUST00000107153] [ENSMUST00000124552] [ENSMUST00000126085] [ENSMUST00000127891] [ENSMUST00000135998] [ENSMUST00000136757] [ENSMUST00000178078] [ENSMUST00000151840] [ENSMUST00000144858] [ENSMUST00000154779] [ENSMUST00000154853] [ENSMUST00000146605] [ENSMUST00000138060]
AlphaFold E9PWW9
Predicted Effect unknown
Transcript: ENSMUST00000042399
SMART Domains Protein: ENSMUSP00000037409
Gene: ENSMUSG00000035623

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 40 53 N/A INTRINSIC
Pfam:WHIM1 103 153 9.3e-11 PFAM
Pfam:WHIM2 155 187 7.2e-10 PFAM
low complexity region 236 246 N/A INTRINSIC
low complexity region 299 311 N/A INTRINSIC
low complexity region 758 773 N/A INTRINSIC
low complexity region 860 874 N/A INTRINSIC
low complexity region 878 887 N/A INTRINSIC
PHD 896 942 1.57e-11 SMART
low complexity region 960 974 N/A INTRINSIC
low complexity region 986 1008 N/A INTRINSIC
low complexity region 1026 1045 N/A INTRINSIC
low complexity region 1087 1111 N/A INTRINSIC
low complexity region 1125 1143 N/A INTRINSIC
low complexity region 1148 1167 N/A INTRINSIC
low complexity region 1175 1205 N/A INTRINSIC
low complexity region 1207 1213 N/A INTRINSIC
low complexity region 1249 1263 N/A INTRINSIC
low complexity region 1283 1295 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000042627
SMART Domains Protein: ENSMUSP00000035883
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF498 68 115 1.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072725
SMART Domains Protein: ENSMUSP00000072508
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF498 68 115 1.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107153
SMART Domains Protein: ENSMUSP00000102771
Gene: ENSMUSG00000035623

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
Pfam:WHIM1 88 138 2.2e-10 PFAM
Pfam:WHIM2 140 172 9.4e-8 PFAM
Pfam:WHIM3 178 398 2.5e-27 PFAM
low complexity region 743 758 N/A INTRINSIC
low complexity region 845 859 N/A INTRINSIC
low complexity region 863 872 N/A INTRINSIC
PHD 881 927 1.57e-11 SMART
low complexity region 945 959 N/A INTRINSIC
low complexity region 971 993 N/A INTRINSIC
low complexity region 1011 1030 N/A INTRINSIC
low complexity region 1072 1096 N/A INTRINSIC
low complexity region 1110 1128 N/A INTRINSIC
low complexity region 1133 1152 N/A INTRINSIC
low complexity region 1160 1190 N/A INTRINSIC
low complexity region 1192 1198 N/A INTRINSIC
low complexity region 1234 1248 N/A INTRINSIC
low complexity region 1268 1280 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124552
SMART Domains Protein: ENSMUSP00000120661
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
Pfam:DUF498 2 49 8.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126085
SMART Domains Protein: ENSMUSP00000120089
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
SCOP:d1uroa_ 21 60 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127891
Predicted Effect probably benign
Transcript: ENSMUST00000135998
SMART Domains Protein: ENSMUSP00000118391
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF498 34 128 4.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136757
SMART Domains Protein: ENSMUSP00000121940
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
Pfam:DUF498 6 119 2.1e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205430
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156060
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140805
Predicted Effect probably benign
Transcript: ENSMUST00000178078
SMART Domains Protein: ENSMUSP00000137067
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF498 34 147 2.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151840
SMART Domains Protein: ENSMUSP00000115852
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PDB:2Q4Q|B 31 75 5e-23 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000144858
SMART Domains Protein: ENSMUSP00000117205
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
Pfam:DUF498 11 65 3.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154779
SMART Domains Protein: ENSMUSP00000120195
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
transmembrane domain 30 49 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154853
SMART Domains Protein: ENSMUSP00000115672
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF498 34 147 9.4e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146605
SMART Domains Protein: ENSMUSP00000117571
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
Pfam:DUF498 23 136 3.4e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138060
SMART Domains Protein: ENSMUSP00000116214
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
Pfam:DUF498 40 87 1.7e-12 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that interacts with hepatitis B virus X protein (HBX) and facilitates transcription of hepatitis B virus genes by the HBX transcription activator, suggesting a role for this interaction in the virus life cycle. This protein also interacts with SNF2H protein to form the RSF chromatin-remodeling complex, where the SNF2H subunit functions as the nucleosome-dependent ATPase, and this protein as the histone chaperone. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110025L11Rik T C 16: 88,860,873 (GRCm39) probably benign Het
Abcc4 A G 14: 118,865,103 (GRCm39) S308P probably damaging Het
Agr3 G T 12: 35,997,832 (GRCm39) V115L probably damaging Het
Ahr A T 12: 35,557,463 (GRCm39) I319N probably damaging Het
Alpk1 A T 3: 127,473,507 (GRCm39) V832D probably damaging Het
Ano1 T C 7: 144,223,289 (GRCm39) T78A probably benign Het
Apob G A 12: 8,045,585 (GRCm39) G897D probably damaging Het
Arfgef1 A G 1: 10,212,891 (GRCm39) F1677L probably benign Het
Arhgap40 G T 2: 158,374,226 (GRCm39) G217W probably benign Het
Arhgef4 A G 1: 34,761,749 (GRCm39) E335G unknown Het
Calcoco2 T C 11: 95,994,374 (GRCm39) T60A probably damaging Het
Catsperg1 A T 7: 28,889,721 (GRCm39) S741T probably benign Het
Ccdc181 T G 1: 164,105,846 (GRCm39) I27S probably damaging Het
Ceacam9 A T 7: 16,459,334 (GRCm39) Y211F probably damaging Het
Cep41 T C 6: 30,671,318 (GRCm39) probably null Het
Cercam T A 2: 29,759,689 (GRCm39) L45Q probably damaging Het
Cnnm2 G A 19: 46,751,685 (GRCm39) V492M possibly damaging Het
Cntn3 A G 6: 102,180,981 (GRCm39) V738A probably damaging Het
Coq8a T C 1: 179,997,646 (GRCm39) E351G probably damaging Het
Cyp3a57 T C 5: 145,307,538 (GRCm39) probably null Het
Dbn1 T C 13: 55,623,071 (GRCm39) I471V probably benign Het
Ddx21 G T 10: 62,429,782 (GRCm39) Q321K probably benign Het
Dhx8 T C 11: 101,630,634 (GRCm39) V347A probably damaging Het
Dkc1 A G X: 74,144,598 (GRCm39) I215V probably benign Homo
Dlg2 A G 7: 92,077,788 (GRCm39) I685V possibly damaging Het
Dusp11 A C 6: 85,930,363 (GRCm39) N140K probably damaging Het
Ece2 A G 16: 20,459,468 (GRCm39) K454R probably damaging Het
Eno4 T A 19: 58,935,181 (GRCm39) V131E probably damaging Het
Enpep A G 3: 129,097,362 (GRCm39) probably null Het
Etv1 T C 12: 38,885,219 (GRCm39) Y236H probably damaging Het
F2rl2 A G 13: 95,837,140 (GRCm39) T62A probably benign Het
Fbxl21 T C 13: 56,684,862 (GRCm39) V296A probably damaging Het
Fig4 T C 10: 41,148,994 (GRCm39) I153V probably benign Het
Fis1 T A 5: 136,991,951 (GRCm39) N41K possibly damaging Het
Fras1 T A 5: 96,848,427 (GRCm39) M1814K probably benign Het
Frem2 T A 3: 53,451,792 (GRCm39) I2266F probably benign Het
Gm10330 A T 12: 23,829,843 (GRCm39) *113R probably null Het
Gm12185 T A 11: 48,806,367 (GRCm39) I275F probably benign Het
Gsdme A T 6: 50,206,304 (GRCm39) C180S possibly damaging Het
Herc1 A G 9: 66,323,551 (GRCm39) E1355G probably benign Het
Hnrnpm A T 17: 33,869,185 (GRCm39) I453N possibly damaging Het
Hspb9 T C 11: 100,604,896 (GRCm39) L74P probably damaging Het
Ift46 C A 9: 44,695,260 (GRCm39) Y85* probably null Het
Insyn2b T G 11: 34,353,227 (GRCm39) L423R probably damaging Het
Ints3 T C 3: 90,315,817 (GRCm39) T316A possibly damaging Het
Isg20 C T 7: 78,564,076 (GRCm39) probably benign Het
Itga11 T A 9: 62,642,639 (GRCm39) N187K probably damaging Het
Klhl9 G A 4: 88,639,161 (GRCm39) T360I probably damaging Het
Krt39 T A 11: 99,411,826 (GRCm39) I87F probably benign Het
Krtap19-4 G A 16: 88,681,734 (GRCm39) S74F unknown Het
Lgi1 G A 19: 38,289,737 (GRCm39) V268I probably damaging Het
Lrrc46 G A 11: 96,925,719 (GRCm39) P248S probably benign Het
Lrrn4 C T 2: 132,721,488 (GRCm39) V110I probably benign Het
Mamstr C A 7: 45,294,116 (GRCm39) probably benign Het
Micu3 T A 8: 40,833,718 (GRCm39) F451I probably damaging Het
Mid1 C A X: 168,768,044 (GRCm39) D130E possibly damaging Het
Mkks T C 2: 136,722,201 (GRCm39) T319A probably benign Het
Mob3c A G 4: 115,690,968 (GRCm39) probably null Het
Muc6 T C 7: 141,230,554 (GRCm39) E1192G probably benign Het
Ndc80 A G 17: 71,827,753 (GRCm39) probably null Het
Nfx1 A G 4: 41,012,070 (GRCm39) K807E probably benign Het
Nrxn1 A T 17: 90,930,850 (GRCm39) L181Q probably damaging Het
Nsun7 A G 5: 66,418,407 (GRCm39) S46G probably benign Het
Nup98 A T 7: 101,834,038 (GRCm39) L308H probably damaging Het
Or4c115 C A 2: 88,927,860 (GRCm39) W137L probably benign Het
Or52j3 T C 7: 102,836,098 (GRCm39) F97L probably damaging Het
Or6f2 T C 7: 139,756,141 (GRCm39) V36A probably benign Het
Or8k32 T C 2: 86,369,077 (GRCm39) M61V possibly damaging Het
Palb2 T C 7: 121,726,589 (GRCm39) K427R probably damaging Het
Pcdha1 C A 18: 37,063,965 (GRCm39) Q210K probably benign Het
Pcdhb2 T C 18: 37,429,260 (GRCm39) L411P probably damaging Het
Pde4dip C A 3: 97,602,321 (GRCm39) D2252Y probably damaging Het
Plekhg4 T A 8: 106,107,003 (GRCm39) Y899* probably null Het
Plxnb2 G T 15: 89,045,131 (GRCm39) T1105K probably benign Het
Psmd2 T C 16: 20,478,719 (GRCm39) V606A probably damaging Het
Ptprq A T 10: 107,521,043 (GRCm39) F710I probably benign Het
Rad51ap2 A G 12: 11,506,552 (GRCm39) E158G probably damaging Het
Rasip1 T A 7: 45,277,247 (GRCm39) H18Q possibly damaging Het
Rassf8 A G 6: 145,760,808 (GRCm39) K45E probably damaging Het
Rrn3 T A 16: 13,613,940 (GRCm39) M284K probably damaging Het
Rtn2 C A 7: 19,027,820 (GRCm39) N403K probably damaging Het
Rusc1 A G 3: 88,997,027 (GRCm39) W462R probably damaging Het
Sdc3 T A 4: 130,545,907 (GRCm39) probably benign Het
Secisbp2l C T 2: 125,582,657 (GRCm39) G933D possibly damaging Het
Slc12a2 T A 18: 58,039,032 (GRCm39) C537* probably null Het
Slc4a2 G A 5: 24,639,238 (GRCm39) probably null Het
Spsb4 T A 9: 96,877,744 (GRCm39) D193V probably damaging Het
Strn A C 17: 78,984,780 (GRCm39) F288V probably damaging Het
Stx18 G A 5: 38,293,712 (GRCm39) probably benign Het
Tfcp2l1 T A 1: 118,596,378 (GRCm39) M371K probably benign Het
Thnsl1 A G 2: 21,216,352 (GRCm39) probably null Het
Tlr11 C T 14: 50,598,439 (GRCm39) H142Y possibly damaging Het
Tor1aip2 T A 1: 155,940,780 (GRCm39) I362K probably damaging Het
Trmt13 T C 3: 116,383,404 (GRCm39) K125E probably damaging Het
Trpm8 T C 1: 88,264,851 (GRCm39) V320A probably benign Het
Ubr3 A T 2: 69,766,263 (GRCm39) H377L probably damaging Het
Usp8 A G 2: 126,567,349 (GRCm39) R123G probably null Het
Vim T A 2: 13,579,775 (GRCm39) L178Q probably damaging Het
Vmn1r231 A C 17: 21,110,489 (GRCm39) V142G possibly damaging Het
Vmn1r83 A G 7: 12,055,697 (GRCm39) M120T possibly damaging Het
Vwce G T 19: 10,642,012 (GRCm39) V913F possibly damaging Het
Zbtb18 C A 1: 177,275,285 (GRCm39) T215K probably benign Het
Zeb2 A T 2: 44,886,353 (GRCm39) D857E probably damaging Het
Zfp106 G A 2: 120,364,221 (GRCm39) H729Y probably damaging Het
Zfp977 C A 7: 42,229,437 (GRCm39) A363S probably benign Het
Other mutations in Rsf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Rsf1 APN 7 97,331,096 (GRCm39) critical splice donor site probably null 0.00
IGL01160:Rsf1 APN 7 97,334,791 (GRCm39) missense probably damaging 1.00
IGL01780:Rsf1 APN 7 97,313,977 (GRCm39) critical splice donor site probably benign 0.00
IGL01960:Rsf1 APN 7 97,310,782 (GRCm39) missense probably benign 0.00
IGL02487:Rsf1 APN 7 97,288,698 (GRCm39) missense probably damaging 0.99
IGL02814:Rsf1 APN 7 97,310,434 (GRCm39) missense probably damaging 1.00
IGL02972:Rsf1 APN 7 97,310,533 (GRCm39) missense probably benign 0.35
IGL03176:Rsf1 APN 7 97,328,357 (GRCm39) splice site probably benign
IGL03256:Rsf1 APN 7 97,328,211 (GRCm39) missense possibly damaging 0.82
BB011:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
BB014:Rsf1 UTSW 7 97,229,131 (GRCm39) unclassified probably benign
BB018:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
FR4976:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
G1Funyon:Rsf1 UTSW 7 97,311,132 (GRCm39) missense
P0023:Rsf1 UTSW 7 97,311,478 (GRCm39) missense probably damaging 1.00
R0144:Rsf1 UTSW 7 97,285,614 (GRCm39) missense probably damaging 1.00
R0380:Rsf1 UTSW 7 97,229,112 (GRCm39) unclassified probably benign
R0392:Rsf1 UTSW 7 97,328,212 (GRCm39) missense probably benign 0.00
R0422:Rsf1 UTSW 7 97,330,024 (GRCm39) missense probably benign 0.04
R0584:Rsf1 UTSW 7 97,311,335 (GRCm39) missense possibly damaging 0.60
R0636:Rsf1 UTSW 7 97,311,226 (GRCm39) missense possibly damaging 0.74
R0729:Rsf1 UTSW 7 97,328,234 (GRCm39) missense probably damaging 1.00
R0755:Rsf1 UTSW 7 97,229,174 (GRCm39) missense probably damaging 1.00
R0947:Rsf1 UTSW 7 97,318,985 (GRCm39) missense probably damaging 1.00
R1278:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R1376:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R1376:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R1498:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R1525:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R1534:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R1582:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R1591:Rsf1 UTSW 7 97,288,520 (GRCm39) nonsense probably null
R1676:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R1695:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R1710:Rsf1 UTSW 7 97,311,556 (GRCm39) missense possibly damaging 0.50
R1722:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R1764:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R1815:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R1815:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R1815:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R1823:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R1864:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R1884:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R1897:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R1915:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R1928:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R1958:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R1962:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R1962:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R1996:Rsf1 UTSW 7 97,313,839 (GRCm39) missense probably damaging 1.00
R1999:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R2021:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R2022:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R2046:Rsf1 UTSW 7 97,310,884 (GRCm39) missense probably benign 0.00
R2048:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R2093:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R2103:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R2137:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R2167:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R2179:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R2191:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R2207:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R2211:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R2241:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R2264:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R2283:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R2297:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R2307:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R2419:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R2442:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R2696:Rsf1 UTSW 7 97,229,140 (GRCm39) unclassified probably benign
R2764:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R2939:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R2965:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R2972:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R3008:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R3013:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R3026:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R3110:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R3147:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R3427:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R3610:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R3624:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R3753:Rsf1 UTSW 7 97,311,359 (GRCm39) missense probably benign 0.00
R3759:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R3780:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R3794:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R3889:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R3925:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R3964:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R4037:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R4057:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R4057:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R4084:Rsf1 UTSW 7 97,229,126 (GRCm39) unclassified probably benign
R4240:Rsf1 UTSW 7 97,229,142 (GRCm39) unclassified probably benign
R4303:Rsf1 UTSW 7 97,229,127 (GRCm39) unclassified probably benign
R4383:Rsf1 UTSW 7 97,334,683 (GRCm39) missense possibly damaging 0.86
R4492:Rsf1 UTSW 7 97,229,130 (GRCm39) unclassified probably benign
R4525:Rsf1 UTSW 7 97,229,133 (GRCm39) unclassified probably benign
R4530:Rsf1 UTSW 7 97,229,130 (GRCm39) unclassified probably benign
R4543:Rsf1 UTSW 7 97,229,129 (GRCm39) unclassified probably benign
R4629:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R4629:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R4632:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R4633:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R4652:Rsf1 UTSW 7 97,229,126 (GRCm39) unclassified probably benign
R4675:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R4675:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R4677:Rsf1 UTSW 7 97,329,980 (GRCm39) missense possibly damaging 0.82
R4769:Rsf1 UTSW 7 97,325,429 (GRCm39) missense probably damaging 1.00
R4774:Rsf1 UTSW 7 97,229,123 (GRCm39) unclassified probably benign
R4820:Rsf1 UTSW 7 97,229,126 (GRCm39) unclassified probably benign
R4917:Rsf1 UTSW 7 97,311,612 (GRCm39) missense probably damaging 1.00
R4918:Rsf1 UTSW 7 97,311,612 (GRCm39) missense probably damaging 1.00
R4977:Rsf1 UTSW 7 97,229,123 (GRCm39) unclassified probably benign
R4979:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R4994:Rsf1 UTSW 7 97,229,130 (GRCm39) unclassified probably benign
R4994:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R5041:Rsf1 UTSW 7 97,229,132 (GRCm39) unclassified probably benign
R5125:Rsf1 UTSW 7 97,311,079 (GRCm39) missense possibly damaging 0.87
R5178:Rsf1 UTSW 7 97,311,079 (GRCm39) missense possibly damaging 0.87
R5306:Rsf1 UTSW 7 97,229,136 (GRCm39) unclassified probably benign
R5369:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R5371:Rsf1 UTSW 7 97,229,120 (GRCm39) unclassified probably benign
R5403:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R5436:Rsf1 UTSW 7 97,229,138 (GRCm39) unclassified probably benign
R5450:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R5532:Rsf1 UTSW 7 97,329,902 (GRCm39) missense probably damaging 1.00
R5587:Rsf1 UTSW 7 97,311,328 (GRCm39) missense probably benign 0.02
R5657:Rsf1 UTSW 7 97,229,141 (GRCm39) unclassified probably benign
R5689:Rsf1 UTSW 7 97,229,141 (GRCm39) unclassified probably benign
R5745:Rsf1 UTSW 7 97,229,127 (GRCm39) unclassified probably benign
R5748:Rsf1 UTSW 7 97,229,135 (GRCm39) unclassified probably benign
R5773:Rsf1 UTSW 7 97,229,140 (GRCm39) unclassified probably benign
R5859:Rsf1 UTSW 7 97,334,766 (GRCm39) missense probably damaging 1.00
R5938:Rsf1 UTSW 7 97,334,766 (GRCm39) missense probably damaging 1.00
R6001:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6001:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R6001:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R6021:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6025:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6030:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6030:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6035:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6035:Rsf1 UTSW 7 97,311,316 (GRCm39) missense probably benign 0.01
R6035:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6035:Rsf1 UTSW 7 97,311,316 (GRCm39) missense probably benign 0.01
R6036:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6037:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6037:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6073:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6077:Rsf1 UTSW 7 97,229,135 (GRCm39) unclassified probably benign
R6102:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6111:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R6126:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6128:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6130:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6154:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R6154:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R6165:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6166:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R6182:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6189:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6200:Rsf1 UTSW 7 97,229,132 (GRCm39) unclassified probably benign
R6210:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6212:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6214:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6215:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6216:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6232:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6235:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6242:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6243:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6244:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6268:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6269:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6273:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6275:Rsf1 UTSW 7 97,229,130 (GRCm39) unclassified probably benign
R6286:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6291:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6293:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6297:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R6302:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6309:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6312:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R6324:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6343:Rsf1 UTSW 7 97,310,124 (GRCm39) missense probably benign 0.30
R6346:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R6356:Rsf1 UTSW 7 97,311,141 (GRCm39) missense probably benign
R6370:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R6377:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6377:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6378:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6394:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6398:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R6406:Rsf1 UTSW 7 97,229,133 (GRCm39) unclassified probably benign
R6413:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6443:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6453:Rsf1 UTSW 7 97,229,124 (GRCm39) unclassified probably benign
R6471:Rsf1 UTSW 7 97,229,121 (GRCm39) unclassified probably benign
R6473:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6497:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6505:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6561:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6572:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6607:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6611:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6622:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6626:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6636:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6647:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6648:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6669:Rsf1 UTSW 7 97,229,132 (GRCm39) unclassified probably benign
R6673:Rsf1 UTSW 7 97,229,125 (GRCm39) unclassified probably benign
R6679:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R6685:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6694:Rsf1 UTSW 7 97,229,135 (GRCm39) unclassified probably benign
R6694:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6695:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6697:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6726:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6739:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6747:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6751:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6771:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6773:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R6787:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6800:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R6804:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6806:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6815:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6820:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6823:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6829:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6861:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6862:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6869:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6875:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R6889:Rsf1 UTSW 7 97,229,132 (GRCm39) unclassified probably benign
R6897:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6960:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6963:Rsf1 UTSW 7 97,229,117 (GRCm39) unclassified probably benign
R6967:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R6969:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R6977:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R6996:Rsf1 UTSW 7 97,229,118 (GRCm39) unclassified probably benign
R7066:Rsf1 UTSW 7 97,229,125 (GRCm39) unclassified probably benign
R7109:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R7127:Rsf1 UTSW 7 97,229,121 (GRCm39) unclassified probably benign
R7138:Rsf1 UTSW 7 97,319,002 (GRCm39) missense
R7214:Rsf1 UTSW 7 97,229,136 (GRCm39) unclassified probably benign
R7217:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R7238:Rsf1 UTSW 7 97,229,128 (GRCm39) unclassified probably benign
R7246:Rsf1 UTSW 7 97,229,129 (GRCm39) unclassified probably benign
R7253:Rsf1 UTSW 7 97,229,122 (GRCm39) unclassified probably benign
R7294:Rsf1 UTSW 7 97,229,127 (GRCm39) unclassified probably benign
R7305:Rsf1 UTSW 7 97,229,125 (GRCm39) unclassified probably benign
R7309:Rsf1 UTSW 7 97,229,118 (GRCm39) unclassified probably benign
R7352:Rsf1 UTSW 7 97,229,133 (GRCm39) unclassified probably benign
R7380:Rsf1 UTSW 7 97,229,122 (GRCm39) unclassified probably benign
R7393:Rsf1 UTSW 7 97,229,124 (GRCm39) unclassified probably benign
R7395:Rsf1 UTSW 7 97,229,133 (GRCm39) unclassified probably benign
R7411:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R7413:Rsf1 UTSW 7 97,229,128 (GRCm39) unclassified probably benign
R7481:Rsf1 UTSW 7 97,229,124 (GRCm39) unclassified probably benign
R7538:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R7541:Rsf1 UTSW 7 97,229,118 (GRCm39) unclassified probably benign
R7545:Rsf1 UTSW 7 97,229,134 (GRCm39) unclassified probably benign
R7574:Rsf1 UTSW 7 97,310,374 (GRCm39) missense
R7578:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R7599:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R7630:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R7632:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R7710:Rsf1 UTSW 7 97,331,041 (GRCm39) missense
R7711:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R7715:Rsf1 UTSW 7 97,229,119 (GRCm39) unclassified probably benign
R7719:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R7722:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R7729:Rsf1 UTSW 7 97,229,118 (GRCm39) unclassified probably benign
R7734:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R7743:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R7761:Rsf1 UTSW 7 97,229,127 (GRCm39) unclassified probably benign
R7764:Rsf1 UTSW 7 97,229,134 (GRCm39) unclassified probably benign
R7797:Rsf1 UTSW 7 97,310,692 (GRCm39) missense
R7802:Rsf1 UTSW 7 97,310,979 (GRCm39) missense
R7806:Rsf1 UTSW 7 97,229,127 (GRCm39) unclassified probably benign
R7821:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R7823:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R7824:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R7825:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R7826:Rsf1 UTSW 7 97,310,368 (GRCm39) unclassified probably benign
R7841:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R7854:Rsf1 UTSW 7 97,229,131 (GRCm39) unclassified probably benign
R7862:Rsf1 UTSW 7 97,229,130 (GRCm39) unclassified probably benign
R7893:Rsf1 UTSW 7 97,311,165 (GRCm39) missense
R7923:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R7924:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R7927:Rsf1 UTSW 7 97,229,131 (GRCm39) unclassified probably benign
R7931:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R7951:Rsf1 UTSW 7 97,229,119 (GRCm39) unclassified probably benign
R7957:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R7960:Rsf1 UTSW 7 97,229,124 (GRCm39) unclassified probably benign
R7979:Rsf1 UTSW 7 97,334,920 (GRCm39) missense
R7982:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R7991:Rsf1 UTSW 7 97,310,540 (GRCm39) missense
R8028:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R8030:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R8042:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R8062:Rsf1 UTSW 7 97,326,594 (GRCm39) missense
R8076:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R8117:Rsf1 UTSW 7 97,288,464 (GRCm39) splice site probably null
R8132:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R8153:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R8155:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R8166:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R8197:Rsf1 UTSW 7 97,229,121 (GRCm39) unclassified probably benign
R8235:Rsf1 UTSW 7 97,325,461 (GRCm39) utr 3 prime probably benign
R8245:Rsf1 UTSW 7 97,229,122 (GRCm39) unclassified probably benign
R8282:Rsf1 UTSW 7 97,229,127 (GRCm39) frame shift probably null
R8301:Rsf1 UTSW 7 97,311,132 (GRCm39) missense
R8315:Rsf1 UTSW 7 97,229,130 (GRCm39) unclassified probably benign
R8343:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R8370:Rsf1 UTSW 7 97,229,136 (GRCm39) unclassified probably benign
R8372:Rsf1 UTSW 7 97,311,624 (GRCm39) missense
R8376:Rsf1 UTSW 7 97,229,124 (GRCm39) unclassified probably benign
R8382:Rsf1 UTSW 7 97,229,124 (GRCm39) unclassified probably benign
R8392:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R8410:Rsf1 UTSW 7 97,229,124 (GRCm39) unclassified probably benign
R8443:Rsf1 UTSW 7 97,266,103 (GRCm39) missense
R8502:Rsf1 UTSW 7 97,229,121 (GRCm39) unclassified probably benign
R8529:Rsf1 UTSW 7 97,320,074 (GRCm39) utr 3 prime probably benign
R8537:Rsf1 UTSW 7 97,229,121 (GRCm39) unclassified probably benign
R8554:Rsf1 UTSW 7 97,229,130 (GRCm39) unclassified probably benign
R8558:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R8735:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R8742:Rsf1 UTSW 7 97,229,121 (GRCm39) unclassified probably benign
R8772:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R8862:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R8866:Rsf1 UTSW 7 97,229,120 (GRCm39) unclassified probably benign
R8889:Rsf1 UTSW 7 97,328,171 (GRCm39) missense
R8889:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R8891:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R8892:Rsf1 UTSW 7 97,328,171 (GRCm39) missense
R8907:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R8907:Rsf1 UTSW 7 97,229,125 (GRCm39) unclassified probably benign
R8913:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R8916:Rsf1 UTSW 7 97,229,140 (GRCm39) unclassified probably benign
R8924:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R8940:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R8946:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R8947:Rsf1 UTSW 7 97,331,059 (GRCm39) unclassified probably benign
R8951:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R8975:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R9033:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R9044:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R9060:Rsf1 UTSW 7 97,229,130 (GRCm39) unclassified probably benign
R9066:Rsf1 UTSW 7 97,229,118 (GRCm39) unclassified probably benign
R9079:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R9080:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R9094:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R9096:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R9101:Rsf1 UTSW 7 97,229,114 (GRCm39) unclassified probably benign
R9102:Rsf1 UTSW 7 97,229,138 (GRCm39) unclassified probably benign
R9123:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R9125:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R9126:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R9128:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R9157:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R9159:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
R9161:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R9187:Rsf1 UTSW 7 97,229,140 (GRCm39) unclassified probably benign
R9240:Rsf1 UTSW 7 97,229,119 (GRCm39) unclassified probably benign
R9250:Rsf1 UTSW 7 97,229,121 (GRCm39) unclassified probably benign
R9257:Rsf1 UTSW 7 97,334,918 (GRCm39) missense
R9288:Rsf1 UTSW 7 97,229,119 (GRCm39) unclassified probably benign
R9345:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R9406:Rsf1 UTSW 7 97,229,118 (GRCm39) unclassified probably benign
R9411:Rsf1 UTSW 7 97,229,111 (GRCm39) start codon destroyed probably null
R9414:Rsf1 UTSW 7 97,313,765 (GRCm39) critical splice acceptor site probably null
R9420:Rsf1 UTSW 7 97,229,134 (GRCm39) unclassified probably benign
R9421:Rsf1 UTSW 7 97,229,141 (GRCm39) unclassified probably benign
R9423:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R9427:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R9448:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R9452:Rsf1 UTSW 7 97,229,133 (GRCm39) unclassified probably benign
R9454:Rsf1 UTSW 7 97,229,130 (GRCm39) unclassified probably benign
R9467:Rsf1 UTSW 7 97,229,120 (GRCm39) unclassified probably benign
R9468:Rsf1 UTSW 7 97,229,127 (GRCm39) unclassified probably benign
R9483:Rsf1 UTSW 7 97,229,137 (GRCm39) unclassified probably benign
R9488:Rsf1 UTSW 7 97,229,129 (GRCm39) unclassified probably benign
R9502:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R9507:Rsf1 UTSW 7 97,229,141 (GRCm39) unclassified probably benign
R9509:Rsf1 UTSW 7 97,229,127 (GRCm39) unclassified probably benign
R9519:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R9526:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R9537:Rsf1 UTSW 7 97,229,121 (GRCm39) unclassified probably benign
R9581:Rsf1 UTSW 7 97,229,125 (GRCm39) unclassified probably benign
R9590:Rsf1 UTSW 7 97,229,118 (GRCm39) unclassified probably benign
R9592:Rsf1 UTSW 7 97,229,118 (GRCm39) unclassified probably benign
R9618:Rsf1 UTSW 7 97,229,116 (GRCm39) unclassified probably benign
R9630:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R9685:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R9716:Rsf1 UTSW 7 97,229,139 (GRCm39) unclassified probably benign
R9748:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
R9774:Rsf1 UTSW 7 97,229,138 (GRCm39) unclassified probably benign
R9795:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
R9802:Rsf1 UTSW 7 97,229,113 (GRCm39) unclassified probably benign
RF034:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
RF036:Rsf1 UTSW 7 97,229,115 (GRCm39) unclassified probably benign
X0025:Rsf1 UTSW 7 97,285,651 (GRCm39) missense probably damaging 1.00
X0028:Rsf1 UTSW 7 97,310,031 (GRCm39) nonsense probably null
Y4335:Rsf1 UTSW 7 97,229,111 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCGATCTAACTCAGTTCTCGAC -3'
(R):5'- CCAGGGTATCTATGGAGAGCTAAAG -3'

Sequencing Primer
(F):5'- AGTTCTCGACTGCTCCGG -3'
(R):5'- TTCGGGCCGATCGCTTAC -3'
Posted On 2015-10-08