Incidental Mutation 'R4678:Nup98'
ID349765
Institutional Source Beutler Lab
Gene Symbol Nup98
Ensembl Gene ENSMUSG00000063550
Gene Namenucleoporin 98
SynonymsNup96
MMRRC Submission 041931-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4678 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location102119398-102210176 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102184831 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 308 (L308H)
Ref Sequence ENSEMBL: ENSMUSP00000147486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070165] [ENSMUST00000210682] [ENSMUST00000211005] [ENSMUST00000211022] [ENSMUST00000211235]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070165
AA Change: L308H

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000068530
Gene: ENSMUSG00000063550
AA Change: L308H

DomainStartEndE-ValueType
Pfam:Nucleoporin_FG 3 88 4.6e-4 PFAM
Pfam:Nucleoporin_FG 69 170 3.4e-6 PFAM
Pfam:Nucleoporin_FG 210 307 6.1e-5 PFAM
Pfam:Nucleoporin_FG 246 332 2.2e-7 PFAM
Pfam:Nucleoporin_FG 266 359 1.2e-7 PFAM
Pfam:Nucleoporin_FG 309 425 1.8e-2 PFAM
Pfam:Nucleoporin_FG 398 497 2.2e-2 PFAM
low complexity region 594 610 N/A INTRINSIC
low complexity region 673 684 N/A INTRINSIC
Pfam:Nucleoporin2 740 880 5.4e-45 PFAM
PDB:1KO6|D 881 925 1e-16 PDB
low complexity region 926 935 N/A INTRINSIC
low complexity region 1033 1042 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209242
Predicted Effect possibly damaging
Transcript: ENSMUST00000210682
AA Change: L308H

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000211005
AA Change: L308H

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000211022
AA Change: L308H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000211235
AA Change: L308H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000211764
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nuclear pore complexes (NPCs) regulate the transport of macromolecules between the nucleus and cytoplasm, and are composed of many polypeptide subunits, many of which belong to the nucleoporin family. This gene belongs to the nucleoporin gene family and encodes a 186 kDa precursor protein that undergoes autoproteolytic cleavage to generate a 98 kDa nucleoporin and 96 kDa nucleoporin. The 98 kDa nucleoporin contains a Gly-Leu-Phe-Gly (GLGF) repeat domain and participates in many cellular processes, including nuclear import, nuclear export, mitotic progression, and regulation of gene expression. The 96 kDa nucleoporin is a scaffold component of the NPC. Proteolytic cleavage is important for targeting of the proteins to the NPC. Translocations between this gene and many other partner genes have been observed in different leukemias. Rearrangements typically result in chimeras with the N-terminal GLGF domain of this gene to the C-terminus of the partner gene. Alternative splicing results in multiple transcript variants encoding different isoforms, at least two of which are proteolytically processed. Some variants lack the region that encodes the 96 kDa nucleoporin. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygotes for a null allele die in utero with a severe growth delay and improper gastrulation and nuclear pore complex assembly/function. Heterozygotes for another null allele show impaired IFN-mediated responses, reduced T and B cell subsets in lymphoid organs and altered T and B cell functions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110025L11Rik T C 16: 89,063,985 probably benign Het
Abcc4 A G 14: 118,627,691 S308P probably damaging Het
Agr3 G T 12: 35,947,833 V115L probably damaging Het
Ahr A T 12: 35,507,464 I319N probably damaging Het
Alpk1 A T 3: 127,679,858 V832D probably damaging Het
Ano1 T C 7: 144,669,552 T78A probably benign Het
Apob G A 12: 7,995,585 G897D probably damaging Het
Arfgef1 A G 1: 10,142,666 F1677L probably benign Het
Arhgap40 G T 2: 158,532,306 G217W probably benign Het
Arhgef4 A G 1: 34,722,668 E335G unknown Het
Calcoco2 T C 11: 96,103,548 T60A probably damaging Het
Catsperg1 A T 7: 29,190,296 S741T probably benign Het
Ccdc181 T G 1: 164,278,277 I27S probably damaging Het
Ceacam9 A T 7: 16,725,409 Y211F probably damaging Het
Cep41 T C 6: 30,671,319 probably null Het
Cercam T A 2: 29,869,677 L45Q probably damaging Het
Cnnm2 G A 19: 46,763,246 V492M possibly damaging Het
Cntn3 A G 6: 102,204,020 V738A probably damaging Het
Coq8a T C 1: 180,170,081 E351G probably damaging Het
Cyp3a57 T C 5: 145,370,728 probably null Het
Dbn1 T C 13: 55,475,258 I471V probably benign Het
Ddx21 G T 10: 62,594,003 Q321K probably benign Het
Dhx8 T C 11: 101,739,808 V347A probably damaging Het
Dkc1 A G X: 75,100,992 I215V probably benign Homo
Dlg2 A G 7: 92,428,580 I685V possibly damaging Het
Dusp11 A C 6: 85,953,381 N140K probably damaging Het
Ece2 A G 16: 20,640,718 K454R probably damaging Het
Eno4 T A 19: 58,946,749 V131E probably damaging Het
Enpep A G 3: 129,303,713 probably null Het
Etv1 T C 12: 38,835,220 Y236H probably damaging Het
F2rl2 A G 13: 95,700,632 T62A probably benign Het
Fam196b T G 11: 34,403,227 L423R probably damaging Het
Fbxl21 T C 13: 56,537,049 V296A probably damaging Het
Fig4 T C 10: 41,272,998 I153V probably benign Het
Fis1 T A 5: 136,963,097 N41K possibly damaging Het
Fras1 T A 5: 96,700,568 M1814K probably benign Het
Frem2 T A 3: 53,544,371 I2266F probably benign Het
Gm10330 A T 12: 23,779,842 *113R probably null Het
Gm12185 T A 11: 48,915,540 I275F probably benign Het
Gsdme A T 6: 50,229,324 C180S possibly damaging Het
Herc1 A G 9: 66,416,269 E1355G probably benign Het
Hnrnpm A T 17: 33,650,211 I453N possibly damaging Het
Hspb9 T C 11: 100,714,070 L74P probably damaging Het
Ift46 C A 9: 44,783,963 Y85* probably null Het
Ints3 T C 3: 90,408,510 T316A possibly damaging Het
Isg20 C T 7: 78,914,328 probably benign Het
Itga11 T A 9: 62,735,357 N187K probably damaging Het
Klhl9 G A 4: 88,720,924 T360I probably damaging Het
Krt39 T A 11: 99,521,000 I87F probably benign Het
Krtap19-4 G A 16: 88,884,846 S74F unknown Het
Lgi1 G A 19: 38,301,289 V268I probably damaging Het
Lrrc46 G A 11: 97,034,893 P248S probably benign Het
Lrrn4 C T 2: 132,879,568 V110I probably benign Het
Mamstr C A 7: 45,644,692 probably benign Het
Micu3 T A 8: 40,380,677 F451I probably damaging Het
Mid1 C A X: 169,985,048 D130E possibly damaging Het
Mkks T C 2: 136,880,281 T319A probably benign Het
Mob3c A G 4: 115,833,771 probably null Het
Muc6 T C 7: 141,644,287 E1192G probably benign Het
Ndc80 A G 17: 71,520,758 probably null Het
Nfx1 A G 4: 41,012,070 K807E probably benign Het
Nrxn1 A T 17: 90,623,422 L181Q probably damaging Het
Nsun7 A G 5: 66,261,064 S46G probably benign Het
Olfr1079 T C 2: 86,538,733 M61V possibly damaging Het
Olfr1220 C A 2: 89,097,516 W137L probably benign Het
Olfr523 T C 7: 140,176,228 V36A probably benign Het
Olfr592 T C 7: 103,186,891 F97L probably damaging Het
Palb2 T C 7: 122,127,366 K427R probably damaging Het
Pcdha1 C A 18: 36,930,912 Q210K probably benign Het
Pcdhb2 T C 18: 37,296,207 L411P probably damaging Het
Pde4dip C A 3: 97,695,005 D2252Y probably damaging Het
Plekhg4 T A 8: 105,380,371 Y899* probably null Het
Plxnb2 G T 15: 89,160,928 T1105K probably benign Het
Psmd2 T C 16: 20,659,969 V606A probably damaging Het
Ptprq A T 10: 107,685,182 F710I probably benign Het
Rad51ap2 A G 12: 11,456,551 E158G probably damaging Het
Rasip1 T A 7: 45,627,823 H18Q possibly damaging Het
Rassf8 A G 6: 145,815,082 K45E probably damaging Het
Rrn3 T A 16: 13,796,076 M284K probably damaging Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Het
Rtn2 C A 7: 19,293,895 N403K probably damaging Het
Rusc1 A G 3: 89,089,720 W462R probably damaging Het
Sdc3 T A 4: 130,818,596 probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc12a2 T A 18: 57,905,960 C537* probably null Het
Slc4a2 G A 5: 24,434,240 probably null Het
Spsb4 T A 9: 96,995,691 D193V probably damaging Het
Strn A C 17: 78,677,351 F288V probably damaging Het
Stx18 G A 5: 38,136,368 probably benign Het
Tfcp2l1 T A 1: 118,668,648 M371K probably benign Het
Thnsl1 A G 2: 21,211,541 probably null Het
Tlr11 C T 14: 50,360,982 H142Y possibly damaging Het
Tor1aip2 T A 1: 156,065,034 I362K probably damaging Het
Trmt13 T C 3: 116,589,755 K125E probably damaging Het
Trpm8 T C 1: 88,337,129 V320A probably benign Het
Ubr3 A T 2: 69,935,919 H377L probably damaging Het
Usp8 A G 2: 126,725,429 R123G probably null Het
Vim T A 2: 13,574,964 L178Q probably damaging Het
Vmn1r231 A C 17: 20,890,227 V142G possibly damaging Het
Vmn1r83 A G 7: 12,321,770 M120T possibly damaging Het
Vwce G T 19: 10,664,648 V913F possibly damaging Het
Zbtb18 C A 1: 177,447,719 T215K probably benign Het
Zeb2 A T 2: 44,996,341 D857E probably damaging Het
Zfp106 G A 2: 120,533,740 H729Y probably damaging Het
Zfp977 C A 7: 42,580,013 A363S probably benign Het
Other mutations in Nup98
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Nup98 APN 7 102194987 missense probably damaging 1.00
IGL00789:Nup98 APN 7 102153971 missense probably benign
IGL00798:Nup98 APN 7 102147204 missense probably damaging 1.00
IGL01562:Nup98 APN 7 102185918 missense probably damaging 0.99
IGL01942:Nup98 APN 7 102194711 missense probably damaging 1.00
IGL02109:Nup98 APN 7 102183486 missense probably benign 0.37
IGL02490:Nup98 APN 7 102152366 missense probably damaging 1.00
IGL03184:Nup98 APN 7 102183545 missense probably damaging 0.99
PIT4519001:Nup98 UTSW 7 102134964 missense probably benign 0.00
R0040:Nup98 UTSW 7 102192034 missense probably damaging 1.00
R0133:Nup98 UTSW 7 102139652 critical splice acceptor site probably null
R0309:Nup98 UTSW 7 102152428 missense probably null
R0471:Nup98 UTSW 7 102138797 missense probably benign 0.13
R0538:Nup98 UTSW 7 102186685 missense probably damaging 1.00
R0650:Nup98 UTSW 7 102152453 missense probably damaging 1.00
R0730:Nup98 UTSW 7 102160716 missense probably damaging 1.00
R0881:Nup98 UTSW 7 102160716 missense probably damaging 1.00
R0900:Nup98 UTSW 7 102160716 missense probably damaging 1.00
R1120:Nup98 UTSW 7 102160716 missense probably damaging 1.00
R1159:Nup98 UTSW 7 102160716 missense probably damaging 1.00
R1469:Nup98 UTSW 7 102138801 missense probably benign 0.00
R1469:Nup98 UTSW 7 102138801 missense probably benign 0.00
R1470:Nup98 UTSW 7 102147306 missense probably damaging 0.98
R1470:Nup98 UTSW 7 102147306 missense probably damaging 0.98
R1545:Nup98 UTSW 7 102134880 missense possibly damaging 0.77
R1775:Nup98 UTSW 7 102134937 missense probably benign 0.03
R1889:Nup98 UTSW 7 102160716 missense probably damaging 1.00
R2080:Nup98 UTSW 7 102180424 missense probably damaging 0.96
R3423:Nup98 UTSW 7 102184877 missense probably benign 0.03
R4361:Nup98 UTSW 7 102145714 missense probably damaging 1.00
R4864:Nup98 UTSW 7 102153196 missense possibly damaging 0.94
R4910:Nup98 UTSW 7 102195800 missense unknown
R4924:Nup98 UTSW 7 102134978 missense probably damaging 1.00
R5068:Nup98 UTSW 7 102145655 missense probably benign 0.00
R5069:Nup98 UTSW 7 102145655 missense probably benign 0.00
R5233:Nup98 UTSW 7 102195822 missense unknown
R5779:Nup98 UTSW 7 102152361 missense probably benign
R5922:Nup98 UTSW 7 102154017 missense probably damaging 1.00
R6010:Nup98 UTSW 7 102180429 missense probably damaging 1.00
R6039:Nup98 UTSW 7 102134795 missense probably benign
R6039:Nup98 UTSW 7 102134795 missense probably benign
R6343:Nup98 UTSW 7 102194750 missense possibly damaging 0.90
R6364:Nup98 UTSW 7 102176315 missense probably damaging 1.00
R6462:Nup98 UTSW 7 102195016 missense probably benign 0.03
R6577:Nup98 UTSW 7 102128846 intron probably null
R6900:Nup98 UTSW 7 102185962 missense probably damaging 1.00
R7205:Nup98 UTSW 7 102195041 missense unknown
R7218:Nup98 UTSW 7 102191900 splice site probably null
R7235:Nup98 UTSW 7 102125284 missense probably damaging 1.00
R7307:Nup98 UTSW 7 102134795 missense probably benign
R7402:Nup98 UTSW 7 102134937 missense probably benign 0.00
R7427:Nup98 UTSW 7 102135001 splice site probably null
R7428:Nup98 UTSW 7 102135001 splice site probably null
R7584:Nup98 UTSW 7 102176389 missense probably benign 0.02
R7646:Nup98 UTSW 7 102154035 missense probably benign 0.01
R7648:Nup98 UTSW 7 102124197 missense possibly damaging 0.94
R7742:Nup98 UTSW 7 102153257 splice site probably null
R7827:Nup98 UTSW 7 102124362 missense probably benign 0.10
R7884:Nup98 UTSW 7 102176349 missense probably benign 0.12
R7942:Nup98 UTSW 7 102152461 splice site probably null
R7967:Nup98 UTSW 7 102176349 missense probably benign 0.12
R8034:Nup98 UTSW 7 102145723 critical splice acceptor site probably null
T0970:Nup98 UTSW 7 102186752 unclassified probably benign
X0054:Nup98 UTSW 7 102147208 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGTCTGATACAAAATCCAGGTC -3'
(R):5'- CAGACGATTGTTGGCTCATTTG -3'

Sequencing Primer
(F):5'- CAGGTCTTCATTATTTGAAAGAAAGG -3'
(R):5'- GGCTCATTTGAGAGAATTTTTGGG -3'
Posted On2015-10-08