Incidental Mutation 'R4678:Ptprq'
ID349781
Institutional Source Beutler Lab
Gene Symbol Ptprq
Ensembl Gene ENSMUSG00000035916
Gene Nameprotein tyrosine phosphatase, receptor type, Q
Synonyms
MMRRC Submission 041931-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.446) question?
Stock #R4678 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location107517049-107720051 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 107685182 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 710 (F710I)
Ref Sequence ENSEMBL: ENSMUSP00000058572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050702]
Predicted Effect probably benign
Transcript: ENSMUST00000050702
AA Change: F710I

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000058572
Gene: ENSMUSG00000035916
AA Change: F710I

DomainStartEndE-ValueType
FN3 57 141 3.17e-13 SMART
FN3 156 294 1.55e-7 SMART
FN3 307 384 4.45e-8 SMART
FN3 398 555 1.17e-7 SMART
FN3 569 648 7.06e-11 SMART
FN3 666 743 7.68e-12 SMART
FN3 760 839 1.88e-6 SMART
FN3 855 932 1.33e-6 SMART
FN3 949 1037 2.31e-6 SMART
FN3 1054 1135 1.24e-6 SMART
FN3 1151 1229 2.39e-8 SMART
FN3 1244 1325 6.29e-8 SMART
FN3 1341 1416 2.87e-11 SMART
FN3 1431 1524 2.82e-10 SMART
FN3 1540 1622 6.35e-4 SMART
FN3 1642 1732 7.93e-5 SMART
transmembrane domain 1907 1929 N/A INTRINSIC
PTPc 2003 2262 1.14e-130 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218399
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the type III receptor-like protein-tyrosine phosphatase family. The encoded protein catalyzes the dephosphorylation of phosphotyrosine and phosphatidylinositol and plays roles in cellular proliferation and differentiation. Mutations at this locus have been linked to autosomal recessive deafness. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for targeted mutations show absence of shaft connectors from vestibular hair bundles, postnatal degeneration in cochlear hair-bundle structure, reduced transducer currents but otherwise normal adaptation properties, a progressive loss of basal-coil cochlear hair cells, and deafness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110025L11Rik T C 16: 89,063,985 probably benign Het
Abcc4 A G 14: 118,627,691 S308P probably damaging Het
Agr3 G T 12: 35,947,833 V115L probably damaging Het
Ahr A T 12: 35,507,464 I319N probably damaging Het
Alpk1 A T 3: 127,679,858 V832D probably damaging Het
Ano1 T C 7: 144,669,552 T78A probably benign Het
Apob G A 12: 7,995,585 G897D probably damaging Het
Arfgef1 A G 1: 10,142,666 F1677L probably benign Het
Arhgap40 G T 2: 158,532,306 G217W probably benign Het
Arhgef4 A G 1: 34,722,668 E335G unknown Het
Calcoco2 T C 11: 96,103,548 T60A probably damaging Het
Catsperg1 A T 7: 29,190,296 S741T probably benign Het
Ccdc181 T G 1: 164,278,277 I27S probably damaging Het
Ceacam9 A T 7: 16,725,409 Y211F probably damaging Het
Cep41 T C 6: 30,671,319 probably null Het
Cercam T A 2: 29,869,677 L45Q probably damaging Het
Cnnm2 G A 19: 46,763,246 V492M possibly damaging Het
Cntn3 A G 6: 102,204,020 V738A probably damaging Het
Coq8a T C 1: 180,170,081 E351G probably damaging Het
Cyp3a57 T C 5: 145,370,728 probably null Het
Dbn1 T C 13: 55,475,258 I471V probably benign Het
Ddx21 G T 10: 62,594,003 Q321K probably benign Het
Dhx8 T C 11: 101,739,808 V347A probably damaging Het
Dkc1 A G X: 75,100,992 I215V probably benign Homo
Dlg2 A G 7: 92,428,580 I685V possibly damaging Het
Dusp11 A C 6: 85,953,381 N140K probably damaging Het
Ece2 A G 16: 20,640,718 K454R probably damaging Het
Eno4 T A 19: 58,946,749 V131E probably damaging Het
Enpep A G 3: 129,303,713 probably null Het
Etv1 T C 12: 38,835,220 Y236H probably damaging Het
F2rl2 A G 13: 95,700,632 T62A probably benign Het
Fam196b T G 11: 34,403,227 L423R probably damaging Het
Fbxl21 T C 13: 56,537,049 V296A probably damaging Het
Fig4 T C 10: 41,272,998 I153V probably benign Het
Fis1 T A 5: 136,963,097 N41K possibly damaging Het
Fras1 T A 5: 96,700,568 M1814K probably benign Het
Frem2 T A 3: 53,544,371 I2266F probably benign Het
Gm10330 A T 12: 23,779,842 *113R probably null Het
Gm12185 T A 11: 48,915,540 I275F probably benign Het
Gsdme A T 6: 50,229,324 C180S possibly damaging Het
Herc1 A G 9: 66,416,269 E1355G probably benign Het
Hnrnpm A T 17: 33,650,211 I453N possibly damaging Het
Hspb9 T C 11: 100,714,070 L74P probably damaging Het
Ift46 C A 9: 44,783,963 Y85* probably null Het
Ints3 T C 3: 90,408,510 T316A possibly damaging Het
Isg20 C T 7: 78,914,328 probably benign Het
Itga11 T A 9: 62,735,357 N187K probably damaging Het
Klhl9 G A 4: 88,720,924 T360I probably damaging Het
Krt39 T A 11: 99,521,000 I87F probably benign Het
Krtap19-4 G A 16: 88,884,846 S74F unknown Het
Lgi1 G A 19: 38,301,289 V268I probably damaging Het
Lrrc46 G A 11: 97,034,893 P248S probably benign Het
Lrrn4 C T 2: 132,879,568 V110I probably benign Het
Mamstr C A 7: 45,644,692 probably benign Het
Micu3 T A 8: 40,380,677 F451I probably damaging Het
Mid1 C A X: 169,985,048 D130E possibly damaging Het
Mkks T C 2: 136,880,281 T319A probably benign Het
Mob3c A G 4: 115,833,771 probably null Het
Muc6 T C 7: 141,644,287 E1192G probably benign Het
Ndc80 A G 17: 71,520,758 probably null Het
Nfx1 A G 4: 41,012,070 K807E probably benign Het
Nrxn1 A T 17: 90,623,422 L181Q probably damaging Het
Nsun7 A G 5: 66,261,064 S46G probably benign Het
Nup98 A T 7: 102,184,831 L308H probably damaging Het
Olfr1079 T C 2: 86,538,733 M61V possibly damaging Het
Olfr1220 C A 2: 89,097,516 W137L probably benign Het
Olfr523 T C 7: 140,176,228 V36A probably benign Het
Olfr592 T C 7: 103,186,891 F97L probably damaging Het
Palb2 T C 7: 122,127,366 K427R probably damaging Het
Pcdha1 C A 18: 36,930,912 Q210K probably benign Het
Pcdhb2 T C 18: 37,296,207 L411P probably damaging Het
Pde4dip C A 3: 97,695,005 D2252Y probably damaging Het
Plekhg4 T A 8: 105,380,371 Y899* probably null Het
Plxnb2 G T 15: 89,160,928 T1105K probably benign Het
Psmd2 T C 16: 20,659,969 V606A probably damaging Het
Rad51ap2 A G 12: 11,456,551 E158G probably damaging Het
Rasip1 T A 7: 45,627,823 H18Q possibly damaging Het
Rassf8 A G 6: 145,815,082 K45E probably damaging Het
Rrn3 T A 16: 13,796,076 M284K probably damaging Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Het
Rtn2 C A 7: 19,293,895 N403K probably damaging Het
Rusc1 A G 3: 89,089,720 W462R probably damaging Het
Sdc3 T A 4: 130,818,596 probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc12a2 T A 18: 57,905,960 C537* probably null Het
Slc4a2 G A 5: 24,434,240 probably null Het
Spsb4 T A 9: 96,995,691 D193V probably damaging Het
Strn A C 17: 78,677,351 F288V probably damaging Het
Stx18 G A 5: 38,136,368 probably benign Het
Tfcp2l1 T A 1: 118,668,648 M371K probably benign Het
Thnsl1 A G 2: 21,211,541 probably null Het
Tlr11 C T 14: 50,360,982 H142Y possibly damaging Het
Tor1aip2 T A 1: 156,065,034 I362K probably damaging Het
Trmt13 T C 3: 116,589,755 K125E probably damaging Het
Trpm8 T C 1: 88,337,129 V320A probably benign Het
Ubr3 A T 2: 69,935,919 H377L probably damaging Het
Usp8 A G 2: 126,725,429 R123G probably null Het
Vim T A 2: 13,574,964 L178Q probably damaging Het
Vmn1r231 A C 17: 20,890,227 V142G possibly damaging Het
Vmn1r83 A G 7: 12,321,770 M120T possibly damaging Het
Vwce G T 19: 10,664,648 V913F possibly damaging Het
Zbtb18 C A 1: 177,447,719 T215K probably benign Het
Zeb2 A T 2: 44,996,341 D857E probably damaging Het
Zfp106 G A 2: 120,533,740 H729Y probably damaging Het
Zfp977 C A 7: 42,580,013 A363S probably benign Het
Other mutations in Ptprq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ptprq APN 10 107576929 missense probably damaging 0.98
IGL00537:Ptprq APN 10 107710522 missense probably benign 0.07
IGL00547:Ptprq APN 10 107718541 missense probably damaging 0.99
IGL00586:Ptprq APN 10 107608122 splice site probably benign
IGL00648:Ptprq APN 10 107646716 missense probably benign 0.10
IGL01123:Ptprq APN 10 107686218 missense probably damaging 0.96
IGL01343:Ptprq APN 10 107638839 missense probably damaging 0.96
IGL01348:Ptprq APN 10 107711904 missense probably damaging 1.00
IGL01433:Ptprq APN 10 107576880 missense probably damaging 0.99
IGL01510:Ptprq APN 10 107712048 missense probably damaging 1.00
IGL01535:Ptprq APN 10 107699596 missense probably benign
IGL01631:Ptprq APN 10 107643538 missense probably benign 0.00
IGL01633:Ptprq APN 10 107699723 splice site probably benign
IGL01702:Ptprq APN 10 107517866 missense probably benign 0.00
IGL01733:Ptprq APN 10 107662599 missense probably benign 0.10
IGL01806:Ptprq APN 10 107699608 missense probably damaging 1.00
IGL01832:Ptprq APN 10 107565839 critical splice donor site probably null
IGL01961:Ptprq APN 10 107643654 missense probably damaging 1.00
IGL02108:Ptprq APN 10 107646617 missense probably damaging 1.00
IGL02120:Ptprq APN 10 107667472 missense probably damaging 1.00
IGL02160:Ptprq APN 10 107653565 missense probably benign 0.00
IGL02178:Ptprq APN 10 107686319 missense probably benign 0.03
IGL02249:Ptprq APN 10 107582359 missense probably damaging 1.00
IGL02267:Ptprq APN 10 107646558 missense probably damaging 1.00
IGL02527:Ptprq APN 10 107686563 missense probably benign 0.04
IGL02529:Ptprq APN 10 107635365 missense probably benign 0.03
IGL02542:Ptprq APN 10 107662555 missense probably damaging 1.00
IGL02582:Ptprq APN 10 107643999 missense probably benign 0.00
IGL02708:Ptprq APN 10 107652700 missense probably damaging 1.00
IGL02894:Ptprq APN 10 107667424 missense probably benign
IGL02903:Ptprq APN 10 107666586 missense possibly damaging 0.51
IGL02951:Ptprq APN 10 107667460 missense probably benign 0.03
IGL02982:Ptprq APN 10 107586684 missense probably damaging 1.00
IGL03000:Ptprq APN 10 107542657 missense probably damaging 1.00
IGL03024:Ptprq APN 10 107685566 missense possibly damaging 0.69
IGL03240:Ptprq APN 10 107688507 missense probably benign
P0043:Ptprq UTSW 10 107580225 missense probably benign 0.03
PIT4812001:Ptprq UTSW 10 107666567 missense probably damaging 1.00
R0200:Ptprq UTSW 10 107685157 missense probably benign
R0268:Ptprq UTSW 10 107705548 missense probably benign
R0276:Ptprq UTSW 10 107542735 critical splice acceptor site probably null
R0279:Ptprq UTSW 10 107608417 missense probably damaging 0.96
R0335:Ptprq UTSW 10 107708728 missense probably benign
R0344:Ptprq UTSW 10 107705582 missense probably benign
R0357:Ptprq UTSW 10 107686199 splice site probably benign
R0454:Ptprq UTSW 10 107582530 nonsense probably null
R0479:Ptprq UTSW 10 107643994 nonsense probably null
R0491:Ptprq UTSW 10 107608175 missense probably damaging 0.98
R0519:Ptprq UTSW 10 107538920 splice site probably benign
R0523:Ptprq UTSW 10 107580220 missense possibly damaging 0.54
R0553:Ptprq UTSW 10 107710627 missense probably benign 0.33
R0746:Ptprq UTSW 10 107517831 missense probably damaging 1.00
R0755:Ptprq UTSW 10 107582539 missense probably benign 0.09
R1434:Ptprq UTSW 10 107586714 missense probably damaging 1.00
R1445:Ptprq UTSW 10 107662562 missense probably damaging 1.00
R1470:Ptprq UTSW 10 107718574 missense probably damaging 0.97
R1470:Ptprq UTSW 10 107718574 missense probably damaging 0.97
R1558:Ptprq UTSW 10 107644043 missense probably damaging 1.00
R1567:Ptprq UTSW 10 107565887 missense probably benign 0.13
R1711:Ptprq UTSW 10 107534699 nonsense probably null
R1720:Ptprq UTSW 10 107686294 missense probably damaging 1.00
R1746:Ptprq UTSW 10 107638830 missense probably damaging 1.00
R1776:Ptprq UTSW 10 107685089 missense probably damaging 1.00
R1822:Ptprq UTSW 10 107718478 missense probably damaging 1.00
R1872:Ptprq UTSW 10 107643999 missense probably benign 0.19
R1944:Ptprq UTSW 10 107582388 missense probably benign 0.23
R1945:Ptprq UTSW 10 107582388 missense probably benign 0.23
R2006:Ptprq UTSW 10 107666546 missense probably damaging 1.00
R2014:Ptprq UTSW 10 107667422 missense probably damaging 0.96
R2015:Ptprq UTSW 10 107667422 missense probably damaging 0.96
R2097:Ptprq UTSW 10 107653493 missense probably benign 0.05
R2172:Ptprq UTSW 10 107590994 nonsense probably null
R2174:Ptprq UTSW 10 107705553 missense probably damaging 1.00
R2248:Ptprq UTSW 10 107643070 splice site probably null
R2404:Ptprq UTSW 10 107686599 missense probably damaging 1.00
R3423:Ptprq UTSW 10 107582476 missense probably damaging 0.99
R3683:Ptprq UTSW 10 107708628 missense probably benign 0.01
R3875:Ptprq UTSW 10 107685104 missense possibly damaging 0.88
R3945:Ptprq UTSW 10 107686392 splice site probably benign
R3946:Ptprq UTSW 10 107686392 splice site probably benign
R3974:Ptprq UTSW 10 107712062 missense possibly damaging 0.88
R3982:Ptprq UTSW 10 107543396 missense probably damaging 0.99
R4105:Ptprq UTSW 10 107572967 missense probably damaging 1.00
R4118:Ptprq UTSW 10 107711920 missense probably benign 0.37
R4175:Ptprq UTSW 10 107711917 missense probably benign
R4231:Ptprq UTSW 10 107686283 nonsense probably null
R4356:Ptprq UTSW 10 107608364 missense probably damaging 0.99
R4435:Ptprq UTSW 10 107685055 missense possibly damaging 0.89
R4679:Ptprq UTSW 10 107685182 missense probably benign 0.19
R4745:Ptprq UTSW 10 107524253 missense probably damaging 1.00
R4771:Ptprq UTSW 10 107688427 missense probably benign
R4778:Ptprq UTSW 10 107591022 missense probably benign 0.15
R4808:Ptprq UTSW 10 107718507 missense probably damaging 1.00
R4809:Ptprq UTSW 10 107563175 missense probably damaging 1.00
R4818:Ptprq UTSW 10 107710581 missense possibly damaging 0.86
R4845:Ptprq UTSW 10 107653532 missense probably benign 0.00
R4901:Ptprq UTSW 10 107688414 missense probably benign 0.01
R4942:Ptprq UTSW 10 107688429 missense probably benign 0.01
R4946:Ptprq UTSW 10 107525734 missense probably benign
R4959:Ptprq UTSW 10 107686555 missense probably damaging 1.00
R4973:Ptprq UTSW 10 107686555 missense probably damaging 1.00
R5007:Ptprq UTSW 10 107608276 missense probably benign 0.00
R5053:Ptprq UTSW 10 107563202 missense probably damaging 1.00
R5055:Ptprq UTSW 10 107534679 missense probably benign 0.37
R5090:Ptprq UTSW 10 107526089 missense probably damaging 1.00
R5158:Ptprq UTSW 10 107534704 missense probably damaging 1.00
R5163:Ptprq UTSW 10 107524331 missense probably damaging 1.00
R5222:Ptprq UTSW 10 107662564 missense probably damaging 0.96
R5244:Ptprq UTSW 10 107586695 missense possibly damaging 0.62
R5249:Ptprq UTSW 10 107699635 missense probably damaging 0.99
R5503:Ptprq UTSW 10 107688328 splice site probably null
R5508:Ptprq UTSW 10 107686231 missense probably benign 0.00
R5601:Ptprq UTSW 10 107608430 missense probably benign
R5722:Ptprq UTSW 10 107686365 missense possibly damaging 0.72
R5819:Ptprq UTSW 10 107719883 start gained probably benign
R5862:Ptprq UTSW 10 107565878 missense probably benign 0.02
R5891:Ptprq UTSW 10 107576895 missense possibly damaging 0.94
R5916:Ptprq UTSW 10 107523513 missense probably damaging 1.00
R6054:Ptprq UTSW 10 107582358 missense probably damaging 1.00
R6058:Ptprq UTSW 10 107635274 missense probably benign 0.00
R6075:Ptprq UTSW 10 107525760 missense probably damaging 1.00
R6101:Ptprq UTSW 10 107580266 missense possibly damaging 0.93
R6189:Ptprq UTSW 10 107517887 missense probably damaging 1.00
R6235:Ptprq UTSW 10 107635338 missense possibly damaging 0.61
R6351:Ptprq UTSW 10 107708668 missense probably damaging 0.99
R6394:Ptprq UTSW 10 107642943 nonsense probably null
R6449:Ptprq UTSW 10 107705583 missense probably benign 0.00
R6526:Ptprq UTSW 10 107542653 nonsense probably null
R6544:Ptprq UTSW 10 107608241 missense probably damaging 1.00
R6609:Ptprq UTSW 10 107572968 missense probably damaging 0.99
R6862:Ptprq UTSW 10 107686225 missense probably damaging 0.96
R6874:Ptprq UTSW 10 107718599 missense possibly damaging 0.80
R6892:Ptprq UTSW 10 107576004 missense probably benign 0.00
R7082:Ptprq UTSW 10 107708730 missense probably benign 0.10
R7210:Ptprq UTSW 10 107685171 missense probably damaging 1.00
R7253:Ptprq UTSW 10 107608273 missense probably benign 0.30
R7293:Ptprq UTSW 10 107635506 nonsense probably null
R7445:Ptprq UTSW 10 107590959 missense probably damaging 1.00
R7632:Ptprq UTSW 10 107711922 missense probably benign 0.32
R7685:Ptprq UTSW 10 107643978
R7703:Ptprq UTSW 10 107644146
Z1088:Ptprq UTSW 10 107699672 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- GGAAATTGTCAGCTAGGTTTACTAC -3'
(R):5'- ATGGCTGCTTCAGTGTCTAAAAC -3'

Sequencing Primer
(F):5'- CATGACCAAGTCTGGTGT -3'
(R):5'- TGCTTCAGTGTCTAAAACAACAAAC -3'
Posted On2015-10-08