Incidental Mutation 'R0267:Abca1'
ID34982
Institutional Source Beutler Lab
Gene Symbol Abca1
Ensembl Gene ENSMUSG00000015243
Gene NameATP-binding cassette, sub-family A (ABC1), member 1
SynonymsABC1
MMRRC Submission 038493-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0267 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location53030787-53159895 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53046105 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 1721 (F1721S)
Ref Sequence ENSEMBL: ENSMUSP00000030010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030010]
Predicted Effect probably damaging
Transcript: ENSMUST00000030010
AA Change: F1721S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030010
Gene: ENSMUSG00000015243
AA Change: F1721S

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Pfam:ABC2_membrane_3 395 841 4.9e-14 PFAM
AAA 925 1122 4.2e-10 SMART
low complexity region 1137 1150 N/A INTRINSIC
Pfam:ABC2_membrane_3 1344 1869 1.7e-53 PFAM
low complexity region 1890 1899 N/A INTRINSIC
AAA 1938 2123 3.04e-7 SMART
low complexity region 2176 2187 N/A INTRINSIC
low complexity region 2222 2237 N/A INTRINSIC
Meta Mutation Damage Score 0.7321 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.7%
  • 10x: 96.2%
  • 20x: 94.0%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. In humans, this protein functions as a cholesterol efflux pump in the cellular lipid removal pathway. Mutations in the human gene have been associated with Tangier's disease and familial high-density lipoprotein deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Many homozygous null mutants die perinatally with placental defects. Survivors show altered steroidogenesis, defective lipid export in Golgi, low serum cholesterol, lipid accumulation in macrophages and lung, reduced fertility and kidney and heart defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 G A 15: 74,529,389 R78H probably damaging Het
Adgrd1 G A 5: 129,139,594 A342T probably benign Het
Adrb1 A T 19: 56,723,491 K374* probably null Het
Aldh18a1 C A 19: 40,573,789 V264F probably benign Het
Aldh1l2 C T 10: 83,522,687 probably benign Het
Alox15 T A 11: 70,346,153 H393L probably damaging Het
Aox2 A G 1: 58,339,446 probably benign Het
Appbp2 T C 11: 85,201,462 Y297C probably damaging Het
Atxn2l T G 7: 126,493,207 Q950P probably damaging Het
Bicd1 A T 6: 149,517,042 D737V probably damaging Het
C9 T C 15: 6,467,458 I212T probably benign Het
Ccdc63 A T 5: 122,117,044 probably benign Het
Chst1 C A 2: 92,613,606 P141Q probably damaging Het
Cped1 T A 6: 22,119,476 F311L probably damaging Het
D6Wsu163e T A 6: 126,946,491 H113Q probably benign Het
Dcn A T 10: 97,506,483 probably benign Het
Dmbx1 C T 4: 115,918,112 A324T probably benign Het
Dock10 G T 1: 80,512,454 Q1618K probably damaging Het
Dpyd A G 3: 118,917,272 E443G probably benign Het
Espl1 T C 15: 102,313,017 V953A possibly damaging Het
Exosc10 T C 4: 148,562,756 L174P probably damaging Het
Foxg1 A G 12: 49,385,582 Y366C probably damaging Het
Fxyd3 T C 7: 31,070,734 probably benign Het
Gbp2 T C 3: 142,630,106 V189A probably benign Het
Gins4 T C 8: 23,229,410 probably benign Het
Gm12789 A G 4: 101,988,122 T3A probably benign Het
Gnb1l T C 16: 18,548,089 probably benign Het
Gtpbp3 T C 8: 71,491,497 L295S probably damaging Het
Hrh4 C A 18: 13,022,398 Y331* probably null Het
Hsd11b1 A T 1: 193,241,397 Y52N probably damaging Het
Jam3 A G 9: 27,106,405 I29T probably benign Het
Kctd16 T A 18: 40,530,877 I353N probably benign Het
Lama4 G T 10: 39,028,639 G246C probably damaging Het
Lhx3 T A 2: 26,203,028 M137L probably benign Het
Morc2a T C 11: 3,678,567 I340T probably benign Het
Myo7a A C 7: 98,054,624 I1969S probably benign Het
Olfr1471 T A 19: 13,445,428 C139S probably damaging Het
Olfr304 T C 7: 86,386,267 E131G possibly damaging Het
Olfr429 A G 1: 174,089,166 N42S probably damaging Het
Pclo T C 5: 14,681,180 L3232P unknown Het
Polr1a T G 6: 71,974,139 I1407M probably damaging Het
Ppip5k2 A G 1: 97,728,997 V817A probably damaging Het
Rbfox3 T C 11: 118,495,240 T280A probably benign Het
Rfx3 T C 19: 27,793,788 D521G probably benign Het
Scn5a C T 9: 119,543,135 V223I probably damaging Het
Sgsm3 T G 15: 81,006,602 M119R probably damaging Het
Slc6a7 T A 18: 60,996,711 M608L probably benign Het
Slit2 A G 5: 48,182,331 probably benign Het
Steap2 T A 5: 5,673,561 I440F probably benign Het
Syn2 T G 6: 115,254,150 probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tfb2m G A 1: 179,533,638 H262Y probably benign Het
Trmt1l A G 1: 151,457,675 probably benign Het
Trpm6 C A 19: 18,823,378 P819T probably benign Het
Ttn G A 2: 76,743,689 A25620V probably damaging Het
Ubn2 T C 6: 38,482,618 probably null Het
Vars T C 17: 35,011,596 probably benign Het
Vip A T 10: 5,644,004 D119V possibly damaging Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Vps33b T C 7: 80,286,054 I405T possibly damaging Het
Zbtb21 T A 16: 97,952,100 S356C probably damaging Het
Zdhhc6 A T 19: 55,308,930 S237T probably benign Het
Zfp142 G A 1: 74,576,064 A427V probably benign Het
Zfp692 T A 11: 58,314,314 V463E possibly damaging Het
Zmynd8 A T 2: 165,828,402 I384N probably damaging Het
Other mutations in Abca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Abca1 APN 4 53059255 critical splice donor site probably null
IGL00778:Abca1 APN 4 53086132 missense probably benign
IGL01013:Abca1 APN 4 53038185 nonsense probably null
IGL01510:Abca1 APN 4 53143979 missense probably damaging 0.97
IGL01608:Abca1 APN 4 53038158 missense probably damaging 1.00
IGL01845:Abca1 APN 4 53090297 missense probably damaging 1.00
IGL02048:Abca1 APN 4 53069831 missense probably damaging 1.00
IGL02249:Abca1 APN 4 53068739 nonsense probably null
IGL02569:Abca1 APN 4 53034061 missense probably damaging 1.00
IGL02622:Abca1 APN 4 53034046 missense probably damaging 0.99
R6720_abca1_529 UTSW 4 53083733 missense probably damaging 1.00
R0042:Abca1 UTSW 4 53059245 splice site probably benign
R0042:Abca1 UTSW 4 53059245 splice site probably benign
R0050:Abca1 UTSW 4 53069910 splice site probably benign
R0107:Abca1 UTSW 4 53080834 missense probably benign 0.00
R0127:Abca1 UTSW 4 53067155 missense probably benign 0.00
R0178:Abca1 UTSW 4 53081953 missense possibly damaging 0.89
R0207:Abca1 UTSW 4 53086039 missense probably damaging 0.97
R0269:Abca1 UTSW 4 53044228 missense probably benign
R0586:Abca1 UTSW 4 53092860 missense probably benign 0.00
R0587:Abca1 UTSW 4 53107035 missense probably benign 0.00
R1403:Abca1 UTSW 4 53059253 splice site probably benign
R1404:Abca1 UTSW 4 53059253 splice site probably benign
R1405:Abca1 UTSW 4 53059253 splice site probably benign
R1558:Abca1 UTSW 4 53092887 missense probably null 0.00
R1655:Abca1 UTSW 4 53050964 missense probably benign
R1662:Abca1 UTSW 4 53090251 splice site probably null
R1769:Abca1 UTSW 4 53074325 missense probably damaging 1.00
R1898:Abca1 UTSW 4 53071977 missense probably benign 0.08
R1945:Abca1 UTSW 4 53061509 frame shift probably null
R1966:Abca1 UTSW 4 53050409 missense probably damaging 1.00
R2055:Abca1 UTSW 4 53069881 missense probably benign
R2185:Abca1 UTSW 4 53089830 missense probably benign 0.12
R2202:Abca1 UTSW 4 53090291 missense probably damaging 0.96
R2203:Abca1 UTSW 4 53090291 missense probably damaging 0.96
R2204:Abca1 UTSW 4 53090291 missense probably damaging 0.96
R3056:Abca1 UTSW 4 53127626 missense probably benign
R3849:Abca1 UTSW 4 53061481 splice site probably benign
R3850:Abca1 UTSW 4 53061481 splice site probably benign
R3906:Abca1 UTSW 4 53067151 missense possibly damaging 0.84
R3908:Abca1 UTSW 4 53067151 missense possibly damaging 0.84
R4050:Abca1 UTSW 4 53044144 missense probably damaging 1.00
R4204:Abca1 UTSW 4 53090369 missense probably benign 0.00
R4225:Abca1 UTSW 4 53085106 missense possibly damaging 0.87
R4577:Abca1 UTSW 4 53062568 missense possibly damaging 0.94
R4979:Abca1 UTSW 4 53085092 splice site probably null
R5022:Abca1 UTSW 4 53041570 frame shift probably null
R5168:Abca1 UTSW 4 53086070 missense probably benign
R5363:Abca1 UTSW 4 53132963 missense probably benign 0.00
R5439:Abca1 UTSW 4 53042381 missense possibly damaging 0.55
R5604:Abca1 UTSW 4 53067168 splice site probably null
R5614:Abca1 UTSW 4 53046132 missense probably damaging 1.00
R5810:Abca1 UTSW 4 53079631 missense probably benign
R6001:Abca1 UTSW 4 53075555 missense possibly damaging 0.68
R6151:Abca1 UTSW 4 53085261 missense probably benign
R6185:Abca1 UTSW 4 53078089 missense probably benign 0.31
R6262:Abca1 UTSW 4 53092917 missense probably benign 0.01
R6455:Abca1 UTSW 4 53042376 missense probably damaging 0.98
R6472:Abca1 UTSW 4 53085991 critical splice donor site probably null
R6564:Abca1 UTSW 4 53034031 missense possibly damaging 0.85
R6720:Abca1 UTSW 4 53083733 missense probably damaging 1.00
R6903:Abca1 UTSW 4 53143952 missense probably benign 0.17
R6960:Abca1 UTSW 4 53072924 missense probably benign 0.00
R7065:Abca1 UTSW 4 53074233 missense probably damaging 0.98
R7142:Abca1 UTSW 4 53082050 missense probably damaging 1.00
R7322:Abca1 UTSW 4 53067151 missense probably damaging 0.97
R7520:Abca1 UTSW 4 53078114 missense probably benign
R7547:Abca1 UTSW 4 53109269 missense probably benign 0.02
R7793:Abca1 UTSW 4 53042367 missense not run
RF005:Abca1 UTSW 4 53049125 missense probably damaging 0.97
RF024:Abca1 UTSW 4 53049125 missense probably damaging 0.97
X0023:Abca1 UTSW 4 53049038 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ACCTGGTGAGACACAAACGTAAGC -3'
(R):5'- TTACTGAGCGTGACACCTTGGC -3'

Sequencing Primer
(F):5'- ACGTAAGCATCCACTGGCG -3'
(R):5'- CCAAGGGTAAAATGCTTGTCAAAC -3'
Posted On2013-05-09