Mutagenetix > Incidental Mutations

Incidental Mutation 'R3162:Ipo9'

349821

Institutional Source

Beutler Lab

Gene Symbol

Ipo9

Ensembl Gene

ENSMUSG00000041879

Gene Name

importin 9

Synonyms

MMRRC Submission

040613-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3162 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

135382312-135430499 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 135409476 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 174 (T174A)

Ref Sequence

ENSEMBL: ENSMUSP00000124779 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041023] [ENSMUST00000161032] [ENSMUST00000161189] [ENSMUST00000161838]

Predicted Effect

probably benign
Transcript: ENSMUST00000041023
AA Change: T174A

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000036093
Gene: ENSMUSG00000041879
AA Change: T174A

Domain	Start	End	E-Value	Type
low complexity region	2	10	N/A	INTRINSIC
IBN_N	43	119	3.83e-7	SMART
low complexity region	911	922	N/A	INTRINSIC
low complexity region	978	990	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000159173

SMART Domains

Protein: ENSMUSP00000123869
Gene: ENSMUSG00000041879

Domain	Start	End	E-Value	Type
low complexity region	1	7	N/A	INTRINSIC
SCOP:d1i6la_	18	49	3e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000161032
AA Change: T174A

PolyPhen 2 Score 0.434 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000124779
Gene: ENSMUSG00000041879
AA Change: T174A

Domain	Start	End	E-Value	Type
low complexity region	2	10	N/A	INTRINSIC
IBN_N	43	119	3.83e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161135

Predicted Effect

probably benign
Transcript: ENSMUST00000161189

SMART Domains

Protein: ENSMUSP00000124492
Gene: ENSMUSG00000041879

Domain	Start	End	E-Value	Type
low complexity region	2	10	N/A	INTRINSIC
SCOP:d1i6la_	21	52	4e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161704

Predicted Effect

probably benign
Transcript: ENSMUST00000161838

SMART Domains

Protein: ENSMUSP00000125646
Gene: ENSMUSG00000041879

Domain	Start	End	E-Value	Type
low complexity region	2	10	N/A	INTRINSIC
SCOP:d1i6la_	21	52	4e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187450

Meta Mutation Damage Score

0.0747

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

98% (62/63)

MGI Phenotype

PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933412E24Rik	T	A	15: 60,016,285	E102V	probably damaging	Het
9930014A18Rik	A	T	15: 60,823,447	V150E	probably damaging	Het
Adcy9	A	G	16: 4,311,588	L715P	probably damaging	Het
Atad2b	C	A	12: 4,939,689	N133K	possibly damaging	Het
AW551984	C	A	9: 39,593,029	R547L	probably damaging	Het
B3galt6	A	G	4: 155,992,007	Y204H	probably benign	Het
Camk1g	T	C	1: 193,359,807	T45A	possibly damaging	Het
Caps2	C	A	10: 112,182,486	Y180*	probably null	Het
Cfap54	T	A	10: 93,045,278	K349N	probably damaging	Het
Copa	T	A	1: 172,091,233	C127S	probably damaging	Het
Dapk2	T	G	9: 66,254,611	V267G	probably damaging	Het
Ddb1	T	C	19: 10,625,971	L881P	probably damaging	Het
Decr1	T	A	4: 15,930,972	D120V	probably damaging	Het
Dennd1c	C	T	17: 57,066,562	G637D	possibly damaging	Het
Dhrs3	A	G	4: 144,919,446	D108G	possibly damaging	Het
Disp1	T	C	1: 183,087,242	K1205E	probably benign	Het
Dusp6	T	C	10: 99,264,082	Y131H	probably damaging	Het
Eif2b2	A	T	12: 85,219,661	M34L	probably benign	Het
Errfi1	G	A	4: 150,867,359	E415K	probably damaging	Het
Ext1	T	C	15: 53,344,604	N254D	possibly damaging	Het
Gm13141	GGTTTCTTGATGCC	G	4: 147,528,104		noncoding transcript	Het
Hnrnpu	T	C	1: 178,331,125		probably benign	Het
Hpx	C	T	7: 105,599,640		probably benign	Het
Hyal3	T	A	9: 107,586,806	C407S	probably damaging	Het
Insr	T	G	8: 3,161,416	N1141T	possibly damaging	Het
Ivd	T	C	2: 118,862,169		probably null	Het
Leprot	C	T	4: 101,657,893	T89I	probably damaging	Het
Msh6	T	C	17: 87,985,481	Y555H	probably damaging	Het
Nup155	G	T	15: 8,148,383	R1083S	possibly damaging	Het
Nusap1	A	T	2: 119,630,404	Q126L	possibly damaging	Het
Olfr1042	T	C	2: 86,160,095	I92V	probably benign	Het
Olfr1351	C	A	10: 79,017,604	T94N	probably benign	Het
Olfr156	T	A	4: 43,820,544	K272N	probably benign	Het
Olfr986	G	T	9: 40,187,605	Q163H	probably benign	Het
Pdik1l	A	G	4: 134,284,250	L94S	probably damaging	Het
Pkdrej	T	A	15: 85,816,617	D1706V	probably damaging	Het
Pkhd1l1	A	G	15: 44,505,528	I856M	probably damaging	Het
Prkcz	A	T	4: 155,290,524	D114E	probably benign	Het
Psap	T	C	10: 60,277,753	L4P	possibly damaging	Het
Ptprk	T	C	10: 28,592,826	V1402A	probably benign	Het
Rai14	T	C	15: 10,633,164	T47A	possibly damaging	Het
Rlf	A	G	4: 121,148,847	S979P	probably damaging	Het
Skiv2l	C	T	17: 34,847,813	W88*	probably null	Het
Srbd1	A	T	17: 86,130,215	D233E	probably benign	Het
Tacr2	A	G	10: 62,265,245	D378G	probably benign	Het
Taok2	A	G	7: 126,875,175	I294T	possibly damaging	Het
Tert	A	G	13: 73,627,409	E93G	possibly damaging	Het
Tns2	A	G	15: 102,113,336	E1118G	possibly damaging	Het
Ttc22	A	T	4: 106,623,079	I177F	probably damaging	Het
Vmn2r86	T	C	10: 130,455,804	R31G	probably damaging	Het
Wdr61	T	A	9: 54,724,189		probably benign	Het
Wnt5a	T	C	14: 28,522,488	Y231H	probably benign	Het
Zw10	T	C	9: 49,077,560	Y709H	probably damaging	Het

Other mutations in Ipo9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00896:Ipo9	APN	1	135400059	missense	probably damaging	1.00
IGL01611:Ipo9	APN	1	135386693	missense	possibly damaging	0.76
IGL01941:Ipo9	APN	1	135408073	missense	possibly damaging	0.95
IGL01944:Ipo9	APN	1	135405886	missense	probably damaging	0.98
IGL01959:Ipo9	APN	1	135420355	critical splice acceptor site	probably null
IGL02649:Ipo9	APN	1	135385934	missense	possibly damaging	0.92
IGL02697:Ipo9	APN	1	135390576	missense	probably benign	0.00
IGL03286:Ipo9	APN	1	135407078	intron	probably benign
FR4304:Ipo9	UTSW	1	135386275	small insertion	probably benign
FR4304:Ipo9	UTSW	1	135386279	nonsense	probably null
FR4340:Ipo9	UTSW	1	135386269	small insertion	probably benign
FR4340:Ipo9	UTSW	1	135386271	small insertion	probably benign
FR4548:Ipo9	UTSW	1	135386275	small insertion	probably benign
FR4589:Ipo9	UTSW	1	135386266	small insertion	probably benign
FR4589:Ipo9	UTSW	1	135386281	small insertion	probably benign
FR4976:Ipo9	UTSW	1	135386281	small insertion	probably benign
R0111:Ipo9	UTSW	1	135405924	missense	probably damaging	0.97
R0238:Ipo9	UTSW	1	135404336	splice site	probably benign
R0239:Ipo9	UTSW	1	135404336	splice site	probably benign
R0279:Ipo9	UTSW	1	135420363	intron	probably benign
R0704:Ipo9	UTSW	1	135386268	small deletion	probably benign
R1070:Ipo9	UTSW	1	135406543	missense	possibly damaging	0.89
R1282:Ipo9	UTSW	1	135402292	missense	possibly damaging	0.48
R1467:Ipo9	UTSW	1	135406543	missense	possibly damaging	0.89
R1467:Ipo9	UTSW	1	135406543	missense	possibly damaging	0.89
R1728:Ipo9	UTSW	1	135386268	small insertion	probably benign
R1728:Ipo9	UTSW	1	135386271	small insertion	probably benign
R1728:Ipo9	UTSW	1	135402250	missense	probably benign
R1729:Ipo9	UTSW	1	135386268	small insertion	probably benign
R1729:Ipo9	UTSW	1	135402250	missense	probably benign
R1730:Ipo9	UTSW	1	135386268	small insertion	probably benign
R1730:Ipo9	UTSW	1	135402250	missense	probably benign
R1739:Ipo9	UTSW	1	135386268	small insertion	probably benign
R1739:Ipo9	UTSW	1	135402250	missense	probably benign
R1762:Ipo9	UTSW	1	135386268	small insertion	probably benign
R1762:Ipo9	UTSW	1	135402250	missense	probably benign
R1783:Ipo9	UTSW	1	135386268	small insertion	probably benign
R1783:Ipo9	UTSW	1	135402250	missense	probably benign
R1784:Ipo9	UTSW	1	135386268	small insertion	probably benign
R1784:Ipo9	UTSW	1	135402250	missense	probably benign
R1785:Ipo9	UTSW	1	135386268	small insertion	probably benign
R1785:Ipo9	UTSW	1	135386281	small insertion	probably benign
R1785:Ipo9	UTSW	1	135402250	missense	probably benign
R1899:Ipo9	UTSW	1	135400146	missense	probably damaging	0.99
R2049:Ipo9	UTSW	1	135386268	small insertion	probably benign
R2049:Ipo9	UTSW	1	135402250	missense	probably benign
R2130:Ipo9	UTSW	1	135386268	small insertion	probably benign
R2130:Ipo9	UTSW	1	135402250	missense	probably benign
R2131:Ipo9	UTSW	1	135386268	small insertion	probably benign
R2131:Ipo9	UTSW	1	135402250	missense	probably benign
R2133:Ipo9	UTSW	1	135386268	small insertion	probably benign
R2133:Ipo9	UTSW	1	135386275	small insertion	probably benign
R2133:Ipo9	UTSW	1	135402250	missense	probably benign
R2136:Ipo9	UTSW	1	135394285	missense	probably damaging	0.98
R2141:Ipo9	UTSW	1	135386268	small insertion	probably benign
R2141:Ipo9	UTSW	1	135402250	missense	probably benign
R2142:Ipo9	UTSW	1	135386268	small insertion	probably benign
R2142:Ipo9	UTSW	1	135386275	small insertion	probably benign
R2142:Ipo9	UTSW	1	135386282	small insertion	probably benign
R2142:Ipo9	UTSW	1	135402250	missense	probably benign
R2356:Ipo9	UTSW	1	135406817	missense	probably benign	0.00
R2923:Ipo9	UTSW	1	135400129	missense	probably benign	0.25
R3161:Ipo9	UTSW	1	135409476	missense	probably benign	0.43
R3162:Ipo9	UTSW	1	135409476	missense	probably benign	0.43
R4086:Ipo9	UTSW	1	135388690	unclassified	probably benign
R4679:Ipo9	UTSW	1	135394169	missense	probably benign
R4816:Ipo9	UTSW	1	135406550	missense	probably benign	0.21
R4956:Ipo9	UTSW	1	135404222	critical splice donor site	probably null
R5052:Ipo9	UTSW	1	135388611	unclassified	probably null
R5055:Ipo9	UTSW	1	135402359	nonsense	probably null
R5230:Ipo9	UTSW	1	135420070	missense	probably damaging	1.00
R5240:Ipo9	UTSW	1	135389606	unclassified	probably benign
R5257:Ipo9	UTSW	1	135385435	missense	probably damaging	1.00
R5340:Ipo9	UTSW	1	135385432	missense	probably benign	0.00
R5560:Ipo9	UTSW	1	135402245	missense	probably damaging	0.99
R5602:Ipo9	UTSW	1	135402245	missense	probably damaging	0.99
R5604:Ipo9	UTSW	1	135402245	missense	probably damaging	0.99
R5654:Ipo9	UTSW	1	135385472	nonsense	probably null
R6018:Ipo9	UTSW	1	135390536	critical splice donor site	probably null
R6128:Ipo9	UTSW	1	135390573	missense	possibly damaging	0.90
R6841:Ipo9	UTSW	1	135386308	missense	probably benign
R7230:Ipo9	UTSW	1	135406758	critical splice donor site	probably benign
R7255:Ipo9	UTSW	1	135385988	missense	probably benign	0.01
R7383:Ipo9	UTSW	1	135388673	missense	probably damaging	1.00
Y5405:Ipo9	UTSW	1	135386269	small insertion	probably benign
Y5405:Ipo9	UTSW	1	135386275	small insertion	probably benign
Y5405:Ipo9	UTSW	1	135386284	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- TCATGAGATCAAAGACTACGGTC -3'
(R):5'- CTCCCCTTCTGACGAATAATGC -3'

Sequencing Primer
(F):5'- CCAGTTTTTGGCATGGGCACC -3'
(R):5'- CTGACGAATAATGCTTCTGGC -3'

Posted On

2015-10-08