Incidental Mutation 'R3162:Ivd'
ID349827
Institutional Source Beutler Lab
Gene Symbol Ivd
Ensembl Gene ENSMUSG00000027332
Gene Nameisovaleryl coenzyme A dehydrogenase
Synonyms
MMRRC Submission 040613-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3162 (G1)
Quality Score209
Status Validated
Chromosome2
Chromosomal Location118861954-118882909 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 118862169 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028807]
Predicted Effect probably null
Transcript: ENSMUST00000028807
SMART Domains Protein: ENSMUSP00000028807
Gene: ENSMUSG00000027332

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Pfam:Acyl-CoA_dh_N 44 158 9.4e-40 PFAM
Pfam:Acyl-CoA_dh_M 162 259 8.1e-31 PFAM
Pfam:Acyl-CoA_dh_1 271 419 2e-42 PFAM
Pfam:Acyl-CoA_dh_2 286 409 6.7e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126082
Meta Mutation Damage Score 0.9495 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Isovaleryl-CoA dehydrogenase (IVD) is a mitochondrial matrix enzyme that catalyzes the third step in leucine catabolism. The genetic deficiency of IVD results in an accumulation of isovaleric acid, which is toxic to the central nervous system and leads to isovaleric acidemia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933412E24Rik T A 15: 60,016,285 E102V probably damaging Het
9930014A18Rik A T 15: 60,823,447 V150E probably damaging Het
Adcy9 A G 16: 4,311,588 L715P probably damaging Het
Atad2b C A 12: 4,939,689 N133K possibly damaging Het
AW551984 C A 9: 39,593,029 R547L probably damaging Het
B3galt6 A G 4: 155,992,007 Y204H probably benign Het
Camk1g T C 1: 193,359,807 T45A possibly damaging Het
Caps2 C A 10: 112,182,486 Y180* probably null Het
Cfap54 T A 10: 93,045,278 K349N probably damaging Het
Copa T A 1: 172,091,233 C127S probably damaging Het
Dapk2 T G 9: 66,254,611 V267G probably damaging Het
Ddb1 T C 19: 10,625,971 L881P probably damaging Het
Decr1 T A 4: 15,930,972 D120V probably damaging Het
Dennd1c C T 17: 57,066,562 G637D possibly damaging Het
Dhrs3 A G 4: 144,919,446 D108G possibly damaging Het
Disp1 T C 1: 183,087,242 K1205E probably benign Het
Dusp6 T C 10: 99,264,082 Y131H probably damaging Het
Eif2b2 A T 12: 85,219,661 M34L probably benign Het
Errfi1 G A 4: 150,867,359 E415K probably damaging Het
Ext1 T C 15: 53,344,604 N254D possibly damaging Het
Gm13141 GGTTTCTTGATGCC G 4: 147,528,104 noncoding transcript Het
Hnrnpu T C 1: 178,331,125 probably benign Het
Hpx C T 7: 105,599,640 probably benign Het
Hyal3 T A 9: 107,586,806 C407S probably damaging Het
Insr T G 8: 3,161,416 N1141T possibly damaging Het
Ipo9 T C 1: 135,409,476 T174A probably benign Het
Leprot C T 4: 101,657,893 T89I probably damaging Het
Msh6 T C 17: 87,985,481 Y555H probably damaging Het
Nup155 G T 15: 8,148,383 R1083S possibly damaging Het
Nusap1 A T 2: 119,630,404 Q126L possibly damaging Het
Olfr1042 T C 2: 86,160,095 I92V probably benign Het
Olfr1351 C A 10: 79,017,604 T94N probably benign Het
Olfr156 T A 4: 43,820,544 K272N probably benign Het
Olfr986 G T 9: 40,187,605 Q163H probably benign Het
Pdik1l A G 4: 134,284,250 L94S probably damaging Het
Pkdrej T A 15: 85,816,617 D1706V probably damaging Het
Pkhd1l1 A G 15: 44,505,528 I856M probably damaging Het
Prkcz A T 4: 155,290,524 D114E probably benign Het
Psap T C 10: 60,277,753 L4P possibly damaging Het
Ptprk T C 10: 28,592,826 V1402A probably benign Het
Rai14 T C 15: 10,633,164 T47A possibly damaging Het
Rlf A G 4: 121,148,847 S979P probably damaging Het
Skiv2l C T 17: 34,847,813 W88* probably null Het
Srbd1 A T 17: 86,130,215 D233E probably benign Het
Tacr2 A G 10: 62,265,245 D378G probably benign Het
Taok2 A G 7: 126,875,175 I294T possibly damaging Het
Tert A G 13: 73,627,409 E93G possibly damaging Het
Tns2 A G 15: 102,113,336 E1118G possibly damaging Het
Ttc22 A T 4: 106,623,079 I177F probably damaging Het
Vmn2r86 T C 10: 130,455,804 R31G probably damaging Het
Wdr61 T A 9: 54,724,189 probably benign Het
Wnt5a T C 14: 28,522,488 Y231H probably benign Het
Zw10 T C 9: 49,077,560 Y709H probably damaging Het
Other mutations in Ivd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Ivd APN 2 118876902 missense probably benign 0.06
IGL01122:Ivd APN 2 118876880 splice site probably benign
IGL01634:Ivd APN 2 118876382 missense probably damaging 1.00
IGL02178:Ivd APN 2 118871434 missense probably benign 0.00
IGL02478:Ivd APN 2 118862091 missense probably benign 0.21
IGL03104:Ivd APN 2 118872903 missense probably benign 0.01
R1335:Ivd UTSW 2 118869442 missense probably benign 0.00
R1823:Ivd UTSW 2 118862034 missense probably benign 0.05
R2008:Ivd UTSW 2 118871500 missense probably benign 0.00
R3162:Ivd UTSW 2 118862169 critical splice donor site probably null
R5011:Ivd UTSW 2 118880465 missense probably damaging 1.00
R5013:Ivd UTSW 2 118880465 missense probably damaging 1.00
R5946:Ivd UTSW 2 118876889 missense possibly damaging 0.49
R6810:Ivd UTSW 2 118869761 missense probably benign
R7055:Ivd UTSW 2 118873249 missense probably damaging 0.99
R7131:Ivd UTSW 2 118869774 missense probably damaging 1.00
R7173:Ivd UTSW 2 118871389 missense probably damaging 1.00
R7302:Ivd UTSW 2 118871504 missense probably benign 0.04
R7490:Ivd UTSW 2 118876892 missense possibly damaging 0.94
R7583:Ivd UTSW 2 118862131 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCCTCCCTGATTGGACAAAG -3'
(R):5'- TAGCTGGAGTTCAAAGCCAG -3'

Sequencing Primer
(F):5'- CCTCCCTGATTGGACAAAGTGTTG -3'
(R):5'- CTGGAGTTCAAAGCCAGGAATCC -3'
Posted On2015-10-08