Incidental Mutation 'R3162:Ttc22'
ID349833
Institutional Source Beutler Lab
Gene Symbol Ttc22
Ensembl Gene ENSMUSG00000034919
Gene Nametetratricopeptide repeat domain 22
Synonyms
MMRRC Submission 040613-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R3162 (G1)
Quality Score216
Status Validated
Chromosome4
Chromosomal Location106622432-106640189 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106623079 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 177 (I177F)
Ref Sequence ENSEMBL: ENSMUSP00000035773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047922]
Predicted Effect probably damaging
Transcript: ENSMUST00000047922
AA Change: I177F

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000035773
Gene: ENSMUSG00000034919
AA Change: I177F

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
low complexity region 46 59 N/A INTRINSIC
TPR 66 99 2.3e1 SMART
Pfam:TPR_8 100 128 2.5e-3 PFAM
TPR 295 328 2.99e1 SMART
TPR 432 465 6.19e-1 SMART
Meta Mutation Damage Score 0.0838 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with seven tetratricopeptide (TPR) repeats. Tetratricopeptide repeat containing motifs are found in a variety of proteins and may mediate protein-protein interactions and chaperone activity. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933412E24Rik T A 15: 60,016,285 E102V probably damaging Het
9930014A18Rik A T 15: 60,823,447 V150E probably damaging Het
Adcy9 A G 16: 4,311,588 L715P probably damaging Het
Atad2b C A 12: 4,939,689 N133K possibly damaging Het
AW551984 C A 9: 39,593,029 R547L probably damaging Het
B3galt6 A G 4: 155,992,007 Y204H probably benign Het
Camk1g T C 1: 193,359,807 T45A possibly damaging Het
Caps2 C A 10: 112,182,486 Y180* probably null Het
Cfap54 T A 10: 93,045,278 K349N probably damaging Het
Copa T A 1: 172,091,233 C127S probably damaging Het
Dapk2 T G 9: 66,254,611 V267G probably damaging Het
Ddb1 T C 19: 10,625,971 L881P probably damaging Het
Decr1 T A 4: 15,930,972 D120V probably damaging Het
Dennd1c C T 17: 57,066,562 G637D possibly damaging Het
Dhrs3 A G 4: 144,919,446 D108G possibly damaging Het
Disp1 T C 1: 183,087,242 K1205E probably benign Het
Dusp6 T C 10: 99,264,082 Y131H probably damaging Het
Eif2b2 A T 12: 85,219,661 M34L probably benign Het
Errfi1 G A 4: 150,867,359 E415K probably damaging Het
Ext1 T C 15: 53,344,604 N254D possibly damaging Het
Gm13141 GGTTTCTTGATGCC G 4: 147,528,104 noncoding transcript Het
Hnrnpu T C 1: 178,331,125 probably benign Het
Hpx C T 7: 105,599,640 probably benign Het
Hyal3 T A 9: 107,586,806 C407S probably damaging Het
Insr T G 8: 3,161,416 N1141T possibly damaging Het
Ipo9 T C 1: 135,409,476 T174A probably benign Het
Ivd T C 2: 118,862,169 probably null Het
Leprot C T 4: 101,657,893 T89I probably damaging Het
Msh6 T C 17: 87,985,481 Y555H probably damaging Het
Nup155 G T 15: 8,148,383 R1083S possibly damaging Het
Nusap1 A T 2: 119,630,404 Q126L possibly damaging Het
Olfr1042 T C 2: 86,160,095 I92V probably benign Het
Olfr1351 C A 10: 79,017,604 T94N probably benign Het
Olfr156 T A 4: 43,820,544 K272N probably benign Het
Olfr986 G T 9: 40,187,605 Q163H probably benign Het
Pdik1l A G 4: 134,284,250 L94S probably damaging Het
Pkdrej T A 15: 85,816,617 D1706V probably damaging Het
Pkhd1l1 A G 15: 44,505,528 I856M probably damaging Het
Prkcz A T 4: 155,290,524 D114E probably benign Het
Psap T C 10: 60,277,753 L4P possibly damaging Het
Ptprk T C 10: 28,592,826 V1402A probably benign Het
Rai14 T C 15: 10,633,164 T47A possibly damaging Het
Rlf A G 4: 121,148,847 S979P probably damaging Het
Skiv2l C T 17: 34,847,813 W88* probably null Het
Srbd1 A T 17: 86,130,215 D233E probably benign Het
Tacr2 A G 10: 62,265,245 D378G probably benign Het
Taok2 A G 7: 126,875,175 I294T possibly damaging Het
Tert A G 13: 73,627,409 E93G possibly damaging Het
Tns2 A G 15: 102,113,336 E1118G possibly damaging Het
Vmn2r86 T C 10: 130,455,804 R31G probably damaging Het
Wdr61 T A 9: 54,724,189 probably benign Het
Wnt5a T C 14: 28,522,488 Y231H probably benign Het
Zw10 T C 9: 49,077,560 Y709H probably damaging Het
Other mutations in Ttc22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01718:Ttc22 APN 4 106638576 missense probably damaging 1.00
IGL01749:Ttc22 APN 4 106638603 missense probably benign 0.04
IGL02189:Ttc22 APN 4 106639157 missense probably benign 0.21
IGL02206:Ttc22 APN 4 106635989 missense probably damaging 1.00
IGL02219:Ttc22 APN 4 106638490 missense probably damaging 0.97
IGL02348:Ttc22 APN 4 106622938 missense probably damaging 1.00
IGL02754:Ttc22 APN 4 106638472 missense probably benign 0.22
IGL02982:Ttc22 APN 4 106638586 missense probably damaging 0.97
R0044:Ttc22 UTSW 4 106636806 missense probably benign
R0607:Ttc22 UTSW 4 106639313 missense possibly damaging 0.72
R0611:Ttc22 UTSW 4 106634184 missense probably damaging 1.00
R1148:Ttc22 UTSW 4 106623031 missense probably damaging 1.00
R1148:Ttc22 UTSW 4 106623031 missense probably damaging 1.00
R1466:Ttc22 UTSW 4 106622780 missense probably damaging 1.00
R1466:Ttc22 UTSW 4 106622780 missense probably damaging 1.00
R1584:Ttc22 UTSW 4 106622780 missense probably damaging 1.00
R1654:Ttc22 UTSW 4 106634211 missense probably damaging 1.00
R1776:Ttc22 UTSW 4 106639040 missense possibly damaging 0.64
R1864:Ttc22 UTSW 4 106636806 missense probably benign
R1886:Ttc22 UTSW 4 106636866 critical splice donor site probably null
R2136:Ttc22 UTSW 4 106622672 missense possibly damaging 0.49
R2156:Ttc22 UTSW 4 106639040 missense probably benign 0.43
R2267:Ttc22 UTSW 4 106639085 missense possibly damaging 0.60
R2698:Ttc22 UTSW 4 106639238 missense probably benign
R3162:Ttc22 UTSW 4 106623079 missense probably damaging 0.97
R3754:Ttc22 UTSW 4 106639081 missense probably damaging 0.99
R5399:Ttc22 UTSW 4 106636757 missense probably damaging 1.00
R5839:Ttc22 UTSW 4 106638520 missense probably damaging 0.99
R6156:Ttc22 UTSW 4 106638583 missense probably benign 0.00
R6678:Ttc22 UTSW 4 106623045 missense probably benign 0.17
R6912:Ttc22 UTSW 4 106638603 missense probably benign 0.04
R7094:Ttc22 UTSW 4 106635907 nonsense probably null
R8166:Ttc22 UTSW 4 106634476 missense probably damaging 0.99
R8253:Ttc22 UTSW 4 106638520 missense probably damaging 0.99
R8334:Ttc22 UTSW 4 106638918 splice site probably null
Z1177:Ttc22 UTSW 4 106622523 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGCATTTCCTGGAAGTGGCC -3'
(R):5'- TGTCTTGGTGCTGAAACAGAAAG -3'

Sequencing Primer
(F):5'- AATCTGGCACACGTCTACGG -3'
(R):5'- AAGCTAGGTGGGCAGCACC -3'
Posted On2015-10-08