Incidental Mutation 'R3162:Prkcz'
ID 349839
Institutional Source Beutler Lab
Gene Symbol Prkcz
Ensembl Gene ENSMUSG00000029053
Gene Name protein kinase C, zeta
Synonyms aPKCzeta, zetaPKC, Pkcz
MMRRC Submission 040613-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3162 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 155344586-155445818 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 155374981 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 114 (D114E)
Ref Sequence ENSEMBL: ENSMUSP00000116042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030922] [ENSMUST00000103178] [ENSMUST00000123652] [ENSMUST00000131975]
AlphaFold Q02956
Predicted Effect probably benign
Transcript: ENSMUST00000030922
AA Change: D222E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030922
Gene: ENSMUSG00000029053
AA Change: D222E

DomainStartEndE-ValueType
PB1 15 98 4.55e-24 SMART
C1 131 180 6.73e-17 SMART
S_TKc 252 518 5.49e-94 SMART
S_TK_X 519 582 2.58e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103178
AA Change: D39E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099467
Gene: ENSMUSG00000029053
AA Change: D39E

DomainStartEndE-ValueType
S_TKc 69 335 5.49e-94 SMART
S_TK_X 336 399 2.58e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123652
AA Change: D39E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125320
Predicted Effect probably benign
Transcript: ENSMUST00000131975
AA Change: D114E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000116042
Gene: ENSMUSG00000029053
AA Change: D114E

DomainStartEndE-ValueType
C1 23 72 6.73e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145373
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) zeta is a member of the PKC family of serine/threonine kinases which are involved in a variety of cellular processes such as proliferation, differentiation and secretion. Unlike the classical PKC isoenzymes which are calcium-dependent, PKC zeta exhibits a kinase activity which is independent of calcium and diacylglycerol but not of phosphatidylserine. Furthermore, it is insensitive to typical PKC inhibitors and cannot be activated by phorbol ester. Unlike the classical PKC isoenzymes, it has only a single zinc finger module. These structural and biochemical properties indicate that the zeta subspecies is related to, but distinct from other isoenzymes of PKC. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Young, not mature, homozygous null mice have reduced B cell numbers and abnormal secondary lymph organ structure. Young mice have fewer Peyer's patches, poor delineation of B & T cell zones, and fewer follicles of small size. Spleens have less prominent B cell follicles and abnormal marginal zones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933412E24Rik T A 15: 59,888,134 (GRCm39) E102V probably damaging Het
9930014A18Rik A T 15: 60,695,296 (GRCm39) V150E probably damaging Het
Adcy9 A G 16: 4,129,452 (GRCm39) L715P probably damaging Het
Atad2b C A 12: 4,989,689 (GRCm39) N133K possibly damaging Het
AW551984 C A 9: 39,504,325 (GRCm39) R547L probably damaging Het
B3galt6 A G 4: 156,076,464 (GRCm39) Y204H probably benign Het
Camk1g T C 1: 193,042,115 (GRCm39) T45A possibly damaging Het
Caps2 C A 10: 112,018,391 (GRCm39) Y180* probably null Het
Cfap54 T A 10: 92,881,140 (GRCm39) K349N probably damaging Het
Copa T A 1: 171,918,800 (GRCm39) C127S probably damaging Het
Dapk2 T G 9: 66,161,893 (GRCm39) V267G probably damaging Het
Ddb1 T C 19: 10,603,335 (GRCm39) L881P probably damaging Het
Decr1 T A 4: 15,930,972 (GRCm39) D120V probably damaging Het
Dennd1c C T 17: 57,373,562 (GRCm39) G637D possibly damaging Het
Dhrs3 A G 4: 144,646,016 (GRCm39) D108G possibly damaging Het
Disp1 T C 1: 182,868,806 (GRCm39) K1205E probably benign Het
Dusp6 T C 10: 99,099,944 (GRCm39) Y131H probably damaging Het
Eif2b2 A T 12: 85,266,435 (GRCm39) M34L probably benign Het
Errfi1 G A 4: 150,951,816 (GRCm39) E415K probably damaging Het
Ext1 T C 15: 53,208,000 (GRCm39) N254D possibly damaging Het
Gm13141 GGTTTCTTGATGCC G 4: 147,612,561 (GRCm39) noncoding transcript Het
Hnrnpu T C 1: 178,158,690 (GRCm39) probably benign Het
Hpx C T 7: 105,248,847 (GRCm39) probably benign Het
Hyal3 T A 9: 107,464,005 (GRCm39) C407S probably damaging Het
Insr T G 8: 3,211,416 (GRCm39) N1141T possibly damaging Het
Ipo9 T C 1: 135,337,214 (GRCm39) T174A probably benign Het
Ivd T C 2: 118,692,650 (GRCm39) probably null Het
Leprot C T 4: 101,515,090 (GRCm39) T89I probably damaging Het
Msh6 T C 17: 88,292,909 (GRCm39) Y555H probably damaging Het
Nup155 G T 15: 8,177,867 (GRCm39) R1083S possibly damaging Het
Nusap1 A T 2: 119,460,885 (GRCm39) Q126L possibly damaging Het
Or13c7b T A 4: 43,820,544 (GRCm39) K272N probably benign Het
Or5al1 T C 2: 85,990,439 (GRCm39) I92V probably benign Het
Or6x1 G T 9: 40,098,901 (GRCm39) Q163H probably benign Het
Or7a35 C A 10: 78,853,438 (GRCm39) T94N probably benign Het
Pdik1l A G 4: 134,011,561 (GRCm39) L94S probably damaging Het
Pkdrej T A 15: 85,700,818 (GRCm39) D1706V probably damaging Het
Pkhd1l1 A G 15: 44,368,924 (GRCm39) I856M probably damaging Het
Psap T C 10: 60,113,575 (GRCm39) L4P possibly damaging Het
Ptprk T C 10: 28,468,822 (GRCm39) V1402A probably benign Het
Rai14 T C 15: 10,633,250 (GRCm39) T47A possibly damaging Het
Rlf A G 4: 121,006,044 (GRCm39) S979P probably damaging Het
Skic2 C T 17: 35,066,789 (GRCm39) W88* probably null Het
Skic8 T A 9: 54,631,473 (GRCm39) probably benign Het
Srbd1 A T 17: 86,437,643 (GRCm39) D233E probably benign Het
Tacr2 A G 10: 62,101,024 (GRCm39) D378G probably benign Het
Taok2 A G 7: 126,474,347 (GRCm39) I294T possibly damaging Het
Tert A G 13: 73,775,528 (GRCm39) E93G possibly damaging Het
Tns2 A G 15: 102,021,771 (GRCm39) E1118G possibly damaging Het
Ttc22 A T 4: 106,480,276 (GRCm39) I177F probably damaging Het
Vmn2r86 T C 10: 130,291,673 (GRCm39) R31G probably damaging Het
Wnt5a T C 14: 28,244,445 (GRCm39) Y231H probably benign Het
Zw10 T C 9: 48,988,860 (GRCm39) Y709H probably damaging Het
Other mutations in Prkcz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Prkcz APN 4 155,378,858 (GRCm39) splice site probably benign
IGL02114:Prkcz APN 4 155,356,047 (GRCm39) missense probably damaging 1.00
IGL02582:Prkcz APN 4 155,355,713 (GRCm39) missense probably damaging 1.00
IGL03010:Prkcz APN 4 155,371,262 (GRCm39) missense probably damaging 1.00
IGL03199:Prkcz APN 4 155,357,441 (GRCm39) missense possibly damaging 0.85
IGL03225:Prkcz APN 4 155,352,652 (GRCm39) missense probably damaging 0.99
IGL03229:Prkcz APN 4 155,346,963 (GRCm39) missense probably benign 0.19
IGL03299:Prkcz APN 4 155,371,247 (GRCm39) missense possibly damaging 0.78
PIT4403001:Prkcz UTSW 4 155,377,613 (GRCm39) critical splice donor site probably null
R0389:Prkcz UTSW 4 155,353,597 (GRCm39) missense probably damaging 1.00
R0443:Prkcz UTSW 4 155,353,597 (GRCm39) missense probably damaging 1.00
R1666:Prkcz UTSW 4 155,374,208 (GRCm39) missense probably damaging 1.00
R1668:Prkcz UTSW 4 155,374,208 (GRCm39) missense probably damaging 1.00
R1686:Prkcz UTSW 4 155,355,713 (GRCm39) missense probably damaging 1.00
R1710:Prkcz UTSW 4 155,346,969 (GRCm39) missense probably damaging 1.00
R2025:Prkcz UTSW 4 155,374,167 (GRCm39) missense probably damaging 1.00
R3162:Prkcz UTSW 4 155,374,981 (GRCm39) missense probably benign 0.00
R4399:Prkcz UTSW 4 155,353,534 (GRCm39) missense possibly damaging 0.86
R4780:Prkcz UTSW 4 155,374,159 (GRCm39) missense probably damaging 1.00
R4923:Prkcz UTSW 4 155,441,946 (GRCm39) missense probably damaging 1.00
R5160:Prkcz UTSW 4 155,377,689 (GRCm39) missense probably benign 0.22
R5510:Prkcz UTSW 4 155,357,393 (GRCm39) splice site probably null
R6278:Prkcz UTSW 4 155,352,652 (GRCm39) missense probably damaging 0.99
R6290:Prkcz UTSW 4 155,440,956 (GRCm39) missense probably damaging 1.00
R6881:Prkcz UTSW 4 155,353,513 (GRCm39) missense possibly damaging 0.90
R7055:Prkcz UTSW 4 155,374,091 (GRCm39) missense probably benign 0.01
R7108:Prkcz UTSW 4 155,371,250 (GRCm39) nonsense probably null
R7241:Prkcz UTSW 4 155,353,516 (GRCm39) missense probably benign 0.00
R7355:Prkcz UTSW 4 155,441,953 (GRCm39) missense probably damaging 1.00
R7466:Prkcz UTSW 4 155,356,059 (GRCm39) missense probably damaging 1.00
R7522:Prkcz UTSW 4 155,355,742 (GRCm39) missense probably damaging 1.00
R7618:Prkcz UTSW 4 155,346,939 (GRCm39) missense probably damaging 1.00
R7753:Prkcz UTSW 4 155,357,425 (GRCm39) missense possibly damaging 0.61
R8079:Prkcz UTSW 4 155,441,962 (GRCm39) missense probably damaging 1.00
R8407:Prkcz UTSW 4 155,352,673 (GRCm39) missense probably damaging 0.99
R8523:Prkcz UTSW 4 155,346,968 (GRCm39) missense probably damaging 1.00
R8824:Prkcz UTSW 4 155,429,285 (GRCm39) start gained probably benign
R9753:Prkcz UTSW 4 155,377,659 (GRCm39) missense probably benign 0.01
X0067:Prkcz UTSW 4 155,439,161 (GRCm39) missense probably benign 0.25
Z1176:Prkcz UTSW 4 155,440,925 (GRCm39) missense probably damaging 1.00
Z1176:Prkcz UTSW 4 155,439,137 (GRCm39) missense probably damaging 1.00
Z1177:Prkcz UTSW 4 155,385,461 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTCAAAAGCCAGGCTGG -3'
(R):5'- GAAGCTGCAGTTTTAAAGGACTC -3'

Sequencing Primer
(F):5'- TTCATGTAACAGCCCCTG -3'
(R):5'- ACTCTTTAAACTGGAGTCTTTTGTG -3'
Posted On 2015-10-08