Incidental Mutation 'R0267:Dmbx1'
ID34984
Institutional Source Beutler Lab
Gene Symbol Dmbx1
Ensembl Gene ENSMUSG00000028707
Gene Namediencephalon/mesencephalon homeobox 1
SynonymsAtx, Cdmx, Dmbx1, Mbx, Otx3
MMRRC Submission 038493-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.796) question?
Stock #R0267 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location115915119-115939926 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 115918112 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 324 (A324T)
Ref Sequence ENSEMBL: ENSMUSP00000120320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064806] [ENSMUST00000084338] [ENSMUST00000124071]
Predicted Effect probably benign
Transcript: ENSMUST00000064806
AA Change: A324T

PolyPhen 2 Score 0.408 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000134457
Gene: ENSMUSG00000028707
AA Change: A324T

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
HOX 66 128 6.07e-26 SMART
low complexity region 172 187 N/A INTRINSIC
low complexity region 235 256 N/A INTRINSIC
low complexity region 284 295 N/A INTRINSIC
low complexity region 330 348 N/A INTRINSIC
Pfam:OAR 349 368 9.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084338
AA Change: A329T

PolyPhen 2 Score 0.285 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000081366
Gene: ENSMUSG00000028707
AA Change: A329T

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
HOX 71 133 6.07e-26 SMART
low complexity region 177 192 N/A INTRINSIC
low complexity region 240 261 N/A INTRINSIC
low complexity region 289 300 N/A INTRINSIC
low complexity region 335 353 N/A INTRINSIC
Pfam:OAR 355 372 3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124071
AA Change: A324T

PolyPhen 2 Score 0.408 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000120320
Gene: ENSMUSG00000028707
AA Change: A324T

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
HOX 66 128 6.07e-26 SMART
low complexity region 172 187 N/A INTRINSIC
low complexity region 235 256 N/A INTRINSIC
low complexity region 284 295 N/A INTRINSIC
low complexity region 330 348 N/A INTRINSIC
Pfam:OAR 349 368 9.2e-9 PFAM
Meta Mutation Damage Score 0.0668 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.7%
  • 10x: 96.2%
  • 20x: 94.0%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the bicoid sub-family of homeodomain-containing transcription factors. The encoded protein acts as a transcription factor and may play a role in brain and sensory organ development. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one null allele display partial postnatal lethality, impaired suckling and postnatal growth, and reduced female fertility. When raised in isolation, mice homozygous for another null allele exhibit decreased body weight, decreased food consumption, and small adipocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,046,105 F1721S probably damaging Het
Adgrb1 G A 15: 74,529,389 R78H probably damaging Het
Adgrd1 G A 5: 129,139,594 A342T probably benign Het
Adrb1 A T 19: 56,723,491 K374* probably null Het
Aldh18a1 C A 19: 40,573,789 V264F probably benign Het
Aldh1l2 C T 10: 83,522,687 probably benign Het
Alox15 T A 11: 70,346,153 H393L probably damaging Het
Aox2 A G 1: 58,339,446 probably benign Het
Appbp2 T C 11: 85,201,462 Y297C probably damaging Het
Atxn2l T G 7: 126,493,207 Q950P probably damaging Het
Bicd1 A T 6: 149,517,042 D737V probably damaging Het
C9 T C 15: 6,467,458 I212T probably benign Het
Ccdc63 A T 5: 122,117,044 probably benign Het
Chst1 C A 2: 92,613,606 P141Q probably damaging Het
Cped1 T A 6: 22,119,476 F311L probably damaging Het
D6Wsu163e T A 6: 126,946,491 H113Q probably benign Het
Dcn A T 10: 97,506,483 probably benign Het
Dock10 G T 1: 80,512,454 Q1618K probably damaging Het
Dpyd A G 3: 118,917,272 E443G probably benign Het
Espl1 T C 15: 102,313,017 V953A possibly damaging Het
Exosc10 T C 4: 148,562,756 L174P probably damaging Het
Foxg1 A G 12: 49,385,582 Y366C probably damaging Het
Fxyd3 T C 7: 31,070,734 probably benign Het
Gbp2 T C 3: 142,630,106 V189A probably benign Het
Gins4 T C 8: 23,229,410 probably benign Het
Gm12789 A G 4: 101,988,122 T3A probably benign Het
Gnb1l T C 16: 18,548,089 probably benign Het
Gtpbp3 T C 8: 71,491,497 L295S probably damaging Het
Hrh4 C A 18: 13,022,398 Y331* probably null Het
Hsd11b1 A T 1: 193,241,397 Y52N probably damaging Het
Jam3 A G 9: 27,106,405 I29T probably benign Het
Kctd16 T A 18: 40,530,877 I353N probably benign Het
Lama4 G T 10: 39,028,639 G246C probably damaging Het
Lhx3 T A 2: 26,203,028 M137L probably benign Het
Morc2a T C 11: 3,678,567 I340T probably benign Het
Myo7a A C 7: 98,054,624 I1969S probably benign Het
Olfr1471 T A 19: 13,445,428 C139S probably damaging Het
Olfr304 T C 7: 86,386,267 E131G possibly damaging Het
Olfr429 A G 1: 174,089,166 N42S probably damaging Het
Pclo T C 5: 14,681,180 L3232P unknown Het
Polr1a T G 6: 71,974,139 I1407M probably damaging Het
Ppip5k2 A G 1: 97,728,997 V817A probably damaging Het
Rbfox3 T C 11: 118,495,240 T280A probably benign Het
Rfx3 T C 19: 27,793,788 D521G probably benign Het
Scn5a C T 9: 119,543,135 V223I probably damaging Het
Sgsm3 T G 15: 81,006,602 M119R probably damaging Het
Slc6a7 T A 18: 60,996,711 M608L probably benign Het
Slit2 A G 5: 48,182,331 probably benign Het
Steap2 T A 5: 5,673,561 I440F probably benign Het
Syn2 T G 6: 115,254,150 probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tfb2m G A 1: 179,533,638 H262Y probably benign Het
Trmt1l A G 1: 151,457,675 probably benign Het
Trpm6 C A 19: 18,823,378 P819T probably benign Het
Ttn G A 2: 76,743,689 A25620V probably damaging Het
Ubn2 T C 6: 38,482,618 probably null Het
Vars T C 17: 35,011,596 probably benign Het
Vip A T 10: 5,644,004 D119V possibly damaging Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Vps33b T C 7: 80,286,054 I405T possibly damaging Het
Zbtb21 T A 16: 97,952,100 S356C probably damaging Het
Zdhhc6 A T 19: 55,308,930 S237T probably benign Het
Zfp142 G A 1: 74,576,064 A427V probably benign Het
Zfp692 T A 11: 58,314,314 V463E possibly damaging Het
Zmynd8 A T 2: 165,828,402 I384N probably damaging Het
Other mutations in Dmbx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Dmbx1 APN 4 115920006 missense probably benign 0.00
IGL02850:Dmbx1 APN 4 115918007 missense probably damaging 1.00
R0014:Dmbx1 UTSW 4 115918024 missense probably damaging 0.99
R0014:Dmbx1 UTSW 4 115918024 missense probably damaging 0.99
R1164:Dmbx1 UTSW 4 115918258 missense probably damaging 1.00
R2567:Dmbx1 UTSW 4 115920292 missense probably damaging 1.00
R3419:Dmbx1 UTSW 4 115920676 missense probably benign 0.21
R5383:Dmbx1 UTSW 4 115918145 missense probably damaging 1.00
R5882:Dmbx1 UTSW 4 115920301 missense probably damaging 1.00
R5999:Dmbx1 UTSW 4 115918176 missense probably damaging 0.98
R7064:Dmbx1 UTSW 4 115918268 missense probably damaging 1.00
R7483:Dmbx1 UTSW 4 115923711 missense probably damaging 1.00
R7829:Dmbx1 UTSW 4 115923907 intron probably benign
R8548:Dmbx1 UTSW 4 115920315 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGGTTGGGTTAGAAGCCAGACAG -3'
(R):5'- CACTGCTTGATTCAGGGGATTGGAG -3'

Sequencing Primer
(F):5'- GCGAAGGTTTTCAATGCTCG -3'
(R):5'- AGTTCCGCCAGCATATGG -3'
Posted On2013-05-09