Incidental Mutation 'R3162:Hpx'
ID349841
Institutional Source Beutler Lab
Gene Symbol Hpx
Ensembl Gene ENSMUSG00000030895
Gene Namehemopexin
SynonymsHpxn, hx
MMRRC Submission 040613-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3162 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location105591613-105600137 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 105599640 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033185] [ENSMUST00000033185] [ENSMUST00000033185] [ENSMUST00000033185] [ENSMUST00000106791] [ENSMUST00000210531] [ENSMUST00000210531] [ENSMUST00000210531] [ENSMUST00000210531]
Predicted Effect probably benign
Transcript: ENSMUST00000033185
SMART Domains Protein: ENSMUSP00000033185
Gene: ENSMUSG00000030895

DomainStartEndE-ValueType
HX 56 93 1.29e0 SMART
HX 97 140 5.52e-8 SMART
Blast:HX 143 186 3e-7 BLAST
HX 187 230 3.48e-5 SMART
HX 261 304 1.07e-5 SMART
HX 306 351 5.49e-3 SMART
Blast:HX 358 403 2e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000033185
SMART Domains Protein: ENSMUSP00000033185
Gene: ENSMUSG00000030895

DomainStartEndE-ValueType
HX 56 93 1.29e0 SMART
HX 97 140 5.52e-8 SMART
Blast:HX 143 186 3e-7 BLAST
HX 187 230 3.48e-5 SMART
HX 261 304 1.07e-5 SMART
HX 306 351 5.49e-3 SMART
Blast:HX 358 403 2e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000033185
SMART Domains Protein: ENSMUSP00000033185
Gene: ENSMUSG00000030895

DomainStartEndE-ValueType
HX 56 93 1.29e0 SMART
HX 97 140 5.52e-8 SMART
Blast:HX 143 186 3e-7 BLAST
HX 187 230 3.48e-5 SMART
HX 261 304 1.07e-5 SMART
HX 306 351 5.49e-3 SMART
Blast:HX 358 403 2e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000033185
SMART Domains Protein: ENSMUSP00000033185
Gene: ENSMUSG00000030895

DomainStartEndE-ValueType
HX 56 93 1.29e0 SMART
HX 97 140 5.52e-8 SMART
Blast:HX 143 186 3e-7 BLAST
HX 187 230 3.48e-5 SMART
HX 261 304 1.07e-5 SMART
HX 306 351 5.49e-3 SMART
Blast:HX 358 403 2e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106791
SMART Domains Protein: ENSMUSP00000102403
Gene: ENSMUSG00000036989

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 151 7.54e-14 SMART
BBC 158 284 2.55e-42 SMART
IG_FLMN 321 421 1.06e-31 SMART
Pfam:NHL 486 513 3.4e-8 PFAM
Pfam:NHL 533 560 7.6e-10 PFAM
Pfam:NHL 575 602 4.4e-7 PFAM
Pfam:NHL 622 649 7.6e-10 PFAM
Pfam:NHL 669 696 2.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210531
Predicted Effect probably benign
Transcript: ENSMUST00000210531
Predicted Effect probably benign
Transcript: ENSMUST00000210531
Predicted Effect probably benign
Transcript: ENSMUST00000210531
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a plasma glycoprotein that binds heme with high affinity. The encoded protein is an acute phase protein that transports heme from the plasma to the liver and may be involved in protecting cells from oxidative stress. [provided by RefSeq, Apr 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene display an essentially normal phenotype. However, they have increased susceptiblity to induced hemolytic stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933412E24Rik T A 15: 60,016,285 E102V probably damaging Het
9930014A18Rik A T 15: 60,823,447 V150E probably damaging Het
Adcy9 A G 16: 4,311,588 L715P probably damaging Het
Atad2b C A 12: 4,939,689 N133K possibly damaging Het
AW551984 C A 9: 39,593,029 R547L probably damaging Het
B3galt6 A G 4: 155,992,007 Y204H probably benign Het
Camk1g T C 1: 193,359,807 T45A possibly damaging Het
Caps2 C A 10: 112,182,486 Y180* probably null Het
Cfap54 T A 10: 93,045,278 K349N probably damaging Het
Copa T A 1: 172,091,233 C127S probably damaging Het
Dapk2 T G 9: 66,254,611 V267G probably damaging Het
Ddb1 T C 19: 10,625,971 L881P probably damaging Het
Decr1 T A 4: 15,930,972 D120V probably damaging Het
Dennd1c C T 17: 57,066,562 G637D possibly damaging Het
Dhrs3 A G 4: 144,919,446 D108G possibly damaging Het
Disp1 T C 1: 183,087,242 K1205E probably benign Het
Dusp6 T C 10: 99,264,082 Y131H probably damaging Het
Eif2b2 A T 12: 85,219,661 M34L probably benign Het
Errfi1 G A 4: 150,867,359 E415K probably damaging Het
Ext1 T C 15: 53,344,604 N254D possibly damaging Het
Gm13141 GGTTTCTTGATGCC G 4: 147,528,104 noncoding transcript Het
Hnrnpu T C 1: 178,331,125 probably benign Het
Hyal3 T A 9: 107,586,806 C407S probably damaging Het
Insr T G 8: 3,161,416 N1141T possibly damaging Het
Ipo9 T C 1: 135,409,476 T174A probably benign Het
Ivd T C 2: 118,862,169 probably null Het
Leprot C T 4: 101,657,893 T89I probably damaging Het
Msh6 T C 17: 87,985,481 Y555H probably damaging Het
Nup155 G T 15: 8,148,383 R1083S possibly damaging Het
Nusap1 A T 2: 119,630,404 Q126L possibly damaging Het
Olfr1042 T C 2: 86,160,095 I92V probably benign Het
Olfr1351 C A 10: 79,017,604 T94N probably benign Het
Olfr156 T A 4: 43,820,544 K272N probably benign Het
Olfr986 G T 9: 40,187,605 Q163H probably benign Het
Pdik1l A G 4: 134,284,250 L94S probably damaging Het
Pkdrej T A 15: 85,816,617 D1706V probably damaging Het
Pkhd1l1 A G 15: 44,505,528 I856M probably damaging Het
Prkcz A T 4: 155,290,524 D114E probably benign Het
Psap T C 10: 60,277,753 L4P possibly damaging Het
Ptprk T C 10: 28,592,826 V1402A probably benign Het
Rai14 T C 15: 10,633,164 T47A possibly damaging Het
Rlf A G 4: 121,148,847 S979P probably damaging Het
Skiv2l C T 17: 34,847,813 W88* probably null Het
Srbd1 A T 17: 86,130,215 D233E probably benign Het
Tacr2 A G 10: 62,265,245 D378G probably benign Het
Taok2 A G 7: 126,875,175 I294T possibly damaging Het
Tert A G 13: 73,627,409 E93G possibly damaging Het
Tns2 A G 15: 102,113,336 E1118G possibly damaging Het
Ttc22 A T 4: 106,623,079 I177F probably damaging Het
Vmn2r86 T C 10: 130,455,804 R31G probably damaging Het
Wdr61 T A 9: 54,724,189 probably benign Het
Wnt5a T C 14: 28,522,488 Y231H probably benign Het
Zw10 T C 9: 49,077,560 Y709H probably damaging Het
Other mutations in Hpx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Hpx APN 7 105591770 missense probably damaging 1.00
IGL01861:Hpx APN 7 105592186 nonsense probably null
IGL02441:Hpx APN 7 105592223 missense probably damaging 1.00
IGL03117:Hpx APN 7 105600071 missense possibly damaging 0.94
IGL03230:Hpx APN 7 105599312 missense probably benign 0.04
IGL03376:Hpx APN 7 105592251 unclassified probably benign
IGL03392:Hpx APN 7 105592402 missense probably damaging 1.00
PIT4520001:Hpx UTSW 7 105592134 missense probably benign 0.00
R0138:Hpx UTSW 7 105592238 missense probably damaging 1.00
R0364:Hpx UTSW 7 105596264 missense probably benign 0.18
R1195:Hpx UTSW 7 105599649 splice site probably benign
R1195:Hpx UTSW 7 105599649 splice site probably benign
R1958:Hpx UTSW 7 105596396 missense probably damaging 1.00
R2007:Hpx UTSW 7 105595574 missense probably damaging 1.00
R2025:Hpx UTSW 7 105595104 missense probably damaging 1.00
R2173:Hpx UTSW 7 105592083 missense probably benign 0.01
R2207:Hpx UTSW 7 105592426 missense probably damaging 1.00
R3849:Hpx UTSW 7 105596291 missense probably damaging 1.00
R4206:Hpx UTSW 7 105595147 missense probably null 0.01
R4510:Hpx UTSW 7 105592088 missense possibly damaging 0.94
R4511:Hpx UTSW 7 105592088 missense possibly damaging 0.94
R4709:Hpx UTSW 7 105600036 missense probably benign 0.05
R5029:Hpx UTSW 7 105591764 missense probably damaging 1.00
R5540:Hpx UTSW 7 105591912 missense possibly damaging 0.67
R5631:Hpx UTSW 7 105595601 missense probably damaging 0.96
R5664:Hpx UTSW 7 105595148 missense probably benign 0.02
R5820:Hpx UTSW 7 105591788 missense possibly damaging 0.89
R5922:Hpx UTSW 7 105595624 missense probably damaging 1.00
R6707:Hpx UTSW 7 105595475 missense probably benign 0.09
R6714:Hpx UTSW 7 105595095 missense probably damaging 0.98
R7356:Hpx UTSW 7 105591710 missense probably damaging 0.99
R7425:Hpx UTSW 7 105591861 missense probably damaging 1.00
R8048:Hpx UTSW 7 105595478 missense probably benign
R8184:Hpx UTSW 7 105592145 missense probably damaging 0.99
X0066:Hpx UTSW 7 105596387 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AAGAAGCTGTTACTGAGACCC -3'
(R):5'- TGGGACCAAGCCAGATTCAG -3'

Sequencing Primer
(F):5'- GCTGTTACTGAGACCCTCATAAAATC -3'
(R):5'- GATGTACCCGGTGAGACCCTAATTC -3'
Posted On2015-10-08