Mutagenetix > Incidental Mutation

Incidental Mutation 'R3162:Insr'

349843

Institutional Source

Beutler Lab

Gene Symbol

Insr

Ensembl Gene

ENSMUSG00000005534

Gene Name

insulin receptor

Synonyms

IR-A, IR-B, D630014A15Rik, 4932439J01Rik, IR, CD220

MMRRC Submission

040613-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.900) question?

Stock #

R3162 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

3122061-3279617 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 3161416 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Threonine at position 1141 (N1141T)

Ref Sequence

ENSEMBL: ENSMUSP00000088837 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091291]

AlphaFold

P15208

PDB Structure

1.35A crystal structure of H-2Kb complexed with the GNYSFYAL peptide [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000091291
AA Change: N1141T

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000088837
Gene: ENSMUSG00000005534
AA Change: N1141T

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:Recep_L_domain	52	164	5e-28	PFAM
FU	231	274	1.66e-10	SMART
Pfam:Recep_L_domain	359	473	2.5e-30	PFAM
FN3	496	602	4.02e1	SMART
FN3	624	821	1.16e-6	SMART
FN3	841	924	3.17e-4	SMART
transmembrane domain	947	969	N/A	INTRINSIC
TyrKc	1013	1280	3.11e-134	SMART
low complexity region	1303	1315	N/A	INTRINSIC
low complexity region	1327	1336	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000208839

Meta Mutation Damage Score

0.3063

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

98% (62/63)

MGI Phenotype

FUNCTION: This gene encodes a member of the receptor tyrosine kinase family of transmembrane signaling proteins that play important roles in cell differentiation, growth and metabolism. The encoded preproprotein undergoes proteolytic processing to generate alpha and beta chains that form a disulfide-linked heterodimer which, in turn homodimerizes to form a mature, functional receptor. Mice lacking the encoded protein develop severe hyperglycemia and hyperketonemia, and die within a couple of days after birth as a result of diabetic ketoacidosis. [provided by RefSeq, Aug 2016]
PHENOTYPE: Null mutants grow slowly and die by 7 days of age with ketoacidosis, high serum insulin and triglycerides, low glycogen stores and fatty livers. Tissue specific knockouts show milder lipid metabolism anomalies. Point mutation heterozygotes exhibit hyperglycemia, hyperinsulinemia and glucosuria. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933412E24Rik	T	A	15: 60,016,285	E102V	probably damaging	Het
9930014A18Rik	A	T	15: 60,823,447	V150E	probably damaging	Het
Adcy9	A	G	16: 4,311,588	L715P	probably damaging	Het
Atad2b	C	A	12: 4,939,689	N133K	possibly damaging	Het
AW551984	C	A	9: 39,593,029	R547L	probably damaging	Het
B3galt6	A	G	4: 155,992,007	Y204H	probably benign	Het
Camk1g	T	C	1: 193,359,807	T45A	possibly damaging	Het
Caps2	C	A	10: 112,182,486	Y180*	probably null	Het
Cfap54	T	A	10: 93,045,278	K349N	probably damaging	Het
Copa	T	A	1: 172,091,233	C127S	probably damaging	Het
Dapk2	T	G	9: 66,254,611	V267G	probably damaging	Het
Ddb1	T	C	19: 10,625,971	L881P	probably damaging	Het
Decr1	T	A	4: 15,930,972	D120V	probably damaging	Het
Dennd1c	C	T	17: 57,066,562	G637D	possibly damaging	Het
Dhrs3	A	G	4: 144,919,446	D108G	possibly damaging	Het
Disp1	T	C	1: 183,087,242	K1205E	probably benign	Het
Dusp6	T	C	10: 99,264,082	Y131H	probably damaging	Het
Eif2b2	A	T	12: 85,219,661	M34L	probably benign	Het
Errfi1	G	A	4: 150,867,359	E415K	probably damaging	Het
Ext1	T	C	15: 53,344,604	N254D	possibly damaging	Het
Gm13141	GGTTTCTTGATGCC	G	4: 147,528,104		noncoding transcript	Het
Hnrnpu	T	C	1: 178,331,125		probably benign	Het
Hpx	C	T	7: 105,599,640		probably benign	Het
Hyal3	T	A	9: 107,586,806	C407S	probably damaging	Het
Ipo9	T	C	1: 135,409,476	T174A	probably benign	Het
Ivd	T	C	2: 118,862,169		probably null	Het
Leprot	C	T	4: 101,657,893	T89I	probably damaging	Het
Msh6	T	C	17: 87,985,481	Y555H	probably damaging	Het
Nup155	G	T	15: 8,148,383	R1083S	possibly damaging	Het
Nusap1	A	T	2: 119,630,404	Q126L	possibly damaging	Het
Olfr1042	T	C	2: 86,160,095	I92V	probably benign	Het
Olfr1351	C	A	10: 79,017,604	T94N	probably benign	Het
Olfr156	T	A	4: 43,820,544	K272N	probably benign	Het
Olfr986	G	T	9: 40,187,605	Q163H	probably benign	Het
Pdik1l	A	G	4: 134,284,250	L94S	probably damaging	Het
Pkdrej	T	A	15: 85,816,617	D1706V	probably damaging	Het
Pkhd1l1	A	G	15: 44,505,528	I856M	probably damaging	Het
Prkcz	A	T	4: 155,290,524	D114E	probably benign	Het
Psap	T	C	10: 60,277,753	L4P	possibly damaging	Het
Ptprk	T	C	10: 28,592,826	V1402A	probably benign	Het
Rai14	T	C	15: 10,633,164	T47A	possibly damaging	Het
Rlf	A	G	4: 121,148,847	S979P	probably damaging	Het
Skiv2l	C	T	17: 34,847,813	W88*	probably null	Het
Srbd1	A	T	17: 86,130,215	D233E	probably benign	Het
Tacr2	A	G	10: 62,265,245	D378G	probably benign	Het
Taok2	A	G	7: 126,875,175	I294T	possibly damaging	Het
Tert	A	G	13: 73,627,409	E93G	possibly damaging	Het
Tns2	A	G	15: 102,113,336	E1118G	possibly damaging	Het
Ttc22	A	T	4: 106,623,079	I177F	probably damaging	Het
Vmn2r86	T	C	10: 130,455,804	R31G	probably damaging	Het
Wdr61	T	A	9: 54,724,189		probably benign	Het
Wnt5a	T	C	14: 28,522,488	Y231H	probably benign	Het
Zw10	T	C	9: 49,077,560	Y709H	probably damaging	Het

Other mutations in Insr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01099:Insr	APN	8	3258682	missense	probably damaging	1.00
IGL01986:Insr	APN	8	3158817	missense	probably damaging	1.00
IGL02135:Insr	APN	8	3258741	missense	probably damaging	1.00
IGL02203:Insr	APN	8	3155817	missense	probably benign	0.18
IGL02220:Insr	APN	8	3159578	missense	probably damaging	1.00
IGL02678:Insr	APN	8	3173570	missense	probably benign	0.00
IGL02961:Insr	APN	8	3258785	missense	probably benign	0.08
IGL03099:Insr	APN	8	3258715	missense	probably damaging	1.00
IGL03125:Insr	APN	8	3184972	missense	possibly damaging	0.87
IGL03290:Insr	APN	8	3258574	missense	probably damaging	1.00
gummi_bear	UTSW	8	3161770	missense	probably damaging	1.00
jellybelly	UTSW	8	3258841	missense	probably damaging	1.00
Patently	UTSW	8	3159475	missense	probably damaging	1.00
trolli	UTSW	8	3198111	missense	probably benign	0.31
R0047:Insr	UTSW	8	3202947	missense	probably damaging	0.97
R0053:Insr	UTSW	8	3155683	missense	probably damaging	1.00
R0053:Insr	UTSW	8	3155683	missense	probably damaging	1.00
R0480:Insr	UTSW	8	3161770	missense	probably damaging	1.00
R0748:Insr	UTSW	8	3258841	missense	probably damaging	1.00
R0919:Insr	UTSW	8	3158769	missense	probably damaging	1.00
R1348:Insr	UTSW	8	3192635	missense	probably damaging	1.00
R1467:Insr	UTSW	8	3169720	missense	probably damaging	0.99
R1467:Insr	UTSW	8	3169720	missense	probably damaging	0.99
R1568:Insr	UTSW	8	3165576	missense	probably benign
R1768:Insr	UTSW	8	3159561	missense	probably damaging	1.00
R2093:Insr	UTSW	8	3204762	missense	probably damaging	1.00
R2111:Insr	UTSW	8	3169748	missense	probably benign	0.17
R2112:Insr	UTSW	8	3169748	missense	probably benign	0.17
R2352:Insr	UTSW	8	3192593	missense	probably damaging	1.00
R2364:Insr	UTSW	8	3174820	missense	probably benign
R2842:Insr	UTSW	8	3202986	missense	probably damaging	1.00
R3162:Insr	UTSW	8	3161416	missense	possibly damaging	0.65
R4081:Insr	UTSW	8	3211391	missense	probably benign	0.00
R4441:Insr	UTSW	8	3194902	missense	probably benign	0.00
R4672:Insr	UTSW	8	3167501	critical splice donor site	probably null
R4687:Insr	UTSW	8	3161709	missense	probably benign	0.42
R4708:Insr	UTSW	8	3211346	intron	probably benign
R4890:Insr	UTSW	8	3198234	missense	probably benign	0.16
R4949:Insr	UTSW	8	3185059	missense	probably benign	0.04
R4996:Insr	UTSW	8	3192665	missense	probably null	0.98
R5073:Insr	UTSW	8	3159475	missense	probably damaging	1.00
R5176:Insr	UTSW	8	3158742	missense	probably benign	0.03
R5200:Insr	UTSW	8	3198059	critical splice donor site	probably null
R5323:Insr	UTSW	8	3202902	missense	probably benign	0.02
R5453:Insr	UTSW	8	3155694	missense	probably benign	0.06
R5516:Insr	UTSW	8	3155764	nonsense	probably null
R5704:Insr	UTSW	8	3185122	missense	possibly damaging	0.52
R5820:Insr	UTSW	8	3155976	missense	probably damaging	1.00
R5879:Insr	UTSW	8	3198173	nonsense	probably null
R5894:Insr	UTSW	8	3174869	missense	possibly damaging	0.88
R5937:Insr	UTSW	8	3174808	missense	probably benign
R5966:Insr	UTSW	8	3258697	missense	probably benign	0.04
R6134:Insr	UTSW	8	3192572	missense	probably damaging	1.00
R6352:Insr	UTSW	8	3173479	critical splice donor site	probably null
R6423:Insr	UTSW	8	3173566	missense	probably benign
R6687:Insr	UTSW	8	3198111	missense	probably benign	0.31
R6985:Insr	UTSW	8	3161372	missense	possibly damaging	0.87
R6993:Insr	UTSW	8	3258752	missense	probably damaging	1.00
R7041:Insr	UTSW	8	3258418	missense	probably benign
R7109:Insr	UTSW	8	3258481	missense	probably benign	0.33
R7216:Insr	UTSW	8	3203034	missense	possibly damaging	0.53
R7287:Insr	UTSW	8	3169717	missense	probably benign	0.00
R7378:Insr	UTSW	8	3198231	missense	probably damaging	1.00
R7525:Insr	UTSW	8	3192642	missense	probably damaging	1.00
R7572:Insr	UTSW	8	3173602	missense	probably benign	0.11
R7636:Insr	UTSW	8	3258709	missense	probably damaging	1.00
R7684:Insr	UTSW	8	3169753	missense	possibly damaging	0.85
R7840:Insr	UTSW	8	3258415	missense	probably benign	0.04
R8075:Insr	UTSW	8	3155862	missense	probably benign	0.17
R8161:Insr	UTSW	8	3258660	missense	probably damaging	1.00
R8220:Insr	UTSW	8	3158702	missense	probably benign	0.01
R8434:Insr	UTSW	8	3165514	splice site	probably benign
R8810:Insr	UTSW	8	3169714	missense	probably benign
R8865:Insr	UTSW	8	3161358	missense	probably damaging	1.00
R8884:Insr	UTSW	8	3155679	missense	probably benign
R9134:Insr	UTSW	8	3258413	missense	probably damaging	1.00
R9359:Insr	UTSW	8	3158717	missense	probably damaging	1.00
R9407:Insr	UTSW	8	3185106	missense	probably benign
R9647:Insr	UTSW	8	3155874	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- GACCCAAGAATCTGCCATGC -3'
(R):5'- TTCAGAAATACCCTGGCTACAC -3'

Sequencing Primer
(F):5'- GAATCTGCCATGCCACCC -3'
(R):5'- TGGCTACACCCCTGACC -3'

Posted On

2015-10-08