Incidental Mutation 'R3162:AW551984'
ID 349844
Institutional Source Beutler Lab
Gene Symbol AW551984
Ensembl Gene ENSMUSG00000038112
Gene Name expressed sequence AW551984
Synonyms
MMRRC Submission 040613-MU
Accession Numbers

Genbank: NM_178737; MGI: 2143322

Essential gene? Probably non essential (E-score: 0.084) question?
Stock # R3162 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 39587396-39604403 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 39593029 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 547 (R547L)
Ref Sequence ENSEMBL: ENSMUSP00000113212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042485] [ENSMUST00000119722]
AlphaFold Q8BGF0
Predicted Effect probably damaging
Transcript: ENSMUST00000042485
AA Change: R547L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042582
Gene: ENSMUSG00000038112
AA Change: R547L

DomainStartEndE-ValueType
VIT 1 131 1.59e-47 SMART
VWA 279 460 1.04e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119722
AA Change: R547L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113212
Gene: ENSMUSG00000038112
AA Change: R547L

DomainStartEndE-ValueType
VIT 1 131 1.59e-47 SMART
VWA 279 460 1.04e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128054
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147753
Meta Mutation Damage Score 0.7123 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933412E24Rik T A 15: 60,016,285 E102V probably damaging Het
9930014A18Rik A T 15: 60,823,447 V150E probably damaging Het
Adcy9 A G 16: 4,311,588 L715P probably damaging Het
Atad2b C A 12: 4,939,689 N133K possibly damaging Het
B3galt6 A G 4: 155,992,007 Y204H probably benign Het
Camk1g T C 1: 193,359,807 T45A possibly damaging Het
Caps2 C A 10: 112,182,486 Y180* probably null Het
Cfap54 T A 10: 93,045,278 K349N probably damaging Het
Copa T A 1: 172,091,233 C127S probably damaging Het
Dapk2 T G 9: 66,254,611 V267G probably damaging Het
Ddb1 T C 19: 10,625,971 L881P probably damaging Het
Decr1 T A 4: 15,930,972 D120V probably damaging Het
Dennd1c C T 17: 57,066,562 G637D possibly damaging Het
Dhrs3 A G 4: 144,919,446 D108G possibly damaging Het
Disp1 T C 1: 183,087,242 K1205E probably benign Het
Dusp6 T C 10: 99,264,082 Y131H probably damaging Het
Eif2b2 A T 12: 85,219,661 M34L probably benign Het
Errfi1 G A 4: 150,867,359 E415K probably damaging Het
Ext1 T C 15: 53,344,604 N254D possibly damaging Het
Gm13141 GGTTTCTTGATGCC G 4: 147,528,104 noncoding transcript Het
Hnrnpu T C 1: 178,331,125 probably benign Het
Hpx C T 7: 105,599,640 probably benign Het
Hyal3 T A 9: 107,586,806 C407S probably damaging Het
Insr T G 8: 3,161,416 N1141T possibly damaging Het
Ipo9 T C 1: 135,409,476 T174A probably benign Het
Ivd T C 2: 118,862,169 probably null Het
Leprot C T 4: 101,657,893 T89I probably damaging Het
Msh6 T C 17: 87,985,481 Y555H probably damaging Het
Nup155 G T 15: 8,148,383 R1083S possibly damaging Het
Nusap1 A T 2: 119,630,404 Q126L possibly damaging Het
Olfr1042 T C 2: 86,160,095 I92V probably benign Het
Olfr1351 C A 10: 79,017,604 T94N probably benign Het
Olfr156 T A 4: 43,820,544 K272N probably benign Het
Olfr986 G T 9: 40,187,605 Q163H probably benign Het
Pdik1l A G 4: 134,284,250 L94S probably damaging Het
Pkdrej T A 15: 85,816,617 D1706V probably damaging Het
Pkhd1l1 A G 15: 44,505,528 I856M probably damaging Het
Prkcz A T 4: 155,290,524 D114E probably benign Het
Psap T C 10: 60,277,753 L4P possibly damaging Het
Ptprk T C 10: 28,592,826 V1402A probably benign Het
Rai14 T C 15: 10,633,164 T47A possibly damaging Het
Rlf A G 4: 121,148,847 S979P probably damaging Het
Skiv2l C T 17: 34,847,813 W88* probably null Het
Srbd1 A T 17: 86,130,215 D233E probably benign Het
Tacr2 A G 10: 62,265,245 D378G probably benign Het
Taok2 A G 7: 126,875,175 I294T possibly damaging Het
Tert A G 13: 73,627,409 E93G possibly damaging Het
Tns2 A G 15: 102,113,336 E1118G possibly damaging Het
Ttc22 A T 4: 106,623,079 I177F probably damaging Het
Vmn2r86 T C 10: 130,455,804 R31G probably damaging Het
Wdr61 T A 9: 54,724,189 probably benign Het
Wnt5a T C 14: 28,522,488 Y231H probably benign Het
Zw10 T C 9: 49,077,560 Y709H probably damaging Het
Other mutations in AW551984
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:AW551984 APN 9 39592849 missense probably benign 0.16
IGL00869:AW551984 APN 9 39593434 splice site probably benign
IGL01411:AW551984 APN 9 39593791 missense possibly damaging 0.69
IGL01744:AW551984 APN 9 39591272 missense probably benign 0.01
IGL02102:AW551984 APN 9 39589691 missense probably damaging 1.00
IGL02149:AW551984 APN 9 39592924 missense probably benign 0.06
IGL02151:AW551984 APN 9 39592945 missense probably benign 0.35
IGL02154:AW551984 APN 9 39589102 missense possibly damaging 0.93
IGL02158:AW551984 APN 9 39599325 missense probably null 0.99
IGL02574:AW551984 APN 9 39589086 missense possibly damaging 0.91
IGL02754:AW551984 APN 9 39596626 nonsense probably null
IGL02754:AW551984 APN 9 39593328 critical splice donor site probably null
IGL02838:AW551984 APN 9 39594643 missense probably damaging 1.00
IGL03240:AW551984 APN 9 39589122 missense probably benign 0.00
IGL03328:AW551984 APN 9 39597116 missense probably damaging 1.00
IGL03374:AW551984 APN 9 39599766 missense possibly damaging 0.52
PIT4260001:AW551984 UTSW 9 39592979 missense probably benign 0.08
R0141:AW551984 UTSW 9 39590644 missense probably damaging 1.00
R0269:AW551984 UTSW 9 39599950 missense probably damaging 1.00
R0365:AW551984 UTSW 9 39599321 missense probably benign 0.14
R0453:AW551984 UTSW 9 39600641 missense probably damaging 1.00
R0481:AW551984 UTSW 9 39600616 missense probably null 1.00
R1005:AW551984 UTSW 9 39593733 nonsense probably null
R1585:AW551984 UTSW 9 39599336 nonsense probably null
R2177:AW551984 UTSW 9 39599815 missense probably benign
R3117:AW551984 UTSW 9 39593360 missense probably benign 0.08
R3119:AW551984 UTSW 9 39593360 missense probably benign 0.08
R3162:AW551984 UTSW 9 39593029 missense probably damaging 1.00
R3836:AW551984 UTSW 9 39597908 unclassified probably benign
R3837:AW551984 UTSW 9 39597908 unclassified probably benign
R3839:AW551984 UTSW 9 39597908 unclassified probably benign
R4299:AW551984 UTSW 9 39592979 missense probably benign 0.08
R4422:AW551984 UTSW 9 39600077 missense probably null 0.00
R4713:AW551984 UTSW 9 39597153 missense probably benign 0.13
R4905:AW551984 UTSW 9 39597158 missense probably damaging 0.99
R4966:AW551984 UTSW 9 39597176 missense possibly damaging 0.92
R5022:AW551984 UTSW 9 39597965 missense probably benign 0.00
R5041:AW551984 UTSW 9 39600598 missense probably damaging 1.00
R5342:AW551984 UTSW 9 39594551 missense probably damaging 1.00
R5383:AW551984 UTSW 9 39590698 missense probably benign
R5443:AW551984 UTSW 9 39598029 missense possibly damaging 0.94
R5532:AW551984 UTSW 9 39597185 missense probably damaging 1.00
R5536:AW551984 UTSW 9 39592873 missense probably benign 0.04
R5586:AW551984 UTSW 9 39591263 missense probably benign 0.01
R5601:AW551984 UTSW 9 39591267 missense possibly damaging 0.87
R5618:AW551984 UTSW 9 39590704 missense probably damaging 1.00
R5701:AW551984 UTSW 9 39592822 missense probably benign 0.01
R6122:AW551984 UTSW 9 39593755 missense probably benign 0.00
R6142:AW551984 UTSW 9 39597114 missense probably benign 0.00
R6272:AW551984 UTSW 9 39598037 missense probably benign 0.06
R6429:AW551984 UTSW 9 39600614 missense probably damaging 1.00
R6659:AW551984 UTSW 9 39589099 missense probably benign 0.00
R6670:AW551984 UTSW 9 39592996 missense probably damaging 1.00
R6791:AW551984 UTSW 9 39600659 missense probably damaging 1.00
R7000:AW551984 UTSW 9 39600789 missense probably benign 0.11
R7077:AW551984 UTSW 9 39591427 missense probably benign
R7083:AW551984 UTSW 9 39597647 missense probably damaging 1.00
R7352:AW551984 UTSW 9 39592925 missense probably benign
R7475:AW551984 UTSW 9 39597940 missense probably damaging 1.00
R7534:AW551984 UTSW 9 39591481 missense probably benign 0.03
R7542:AW551984 UTSW 9 39594631 missense possibly damaging 0.95
R7708:AW551984 UTSW 9 39593755 missense probably benign 0.00
R7729:AW551984 UTSW 9 39599775 missense possibly damaging 0.89
R7955:AW551984 UTSW 9 39596664 missense probably damaging 1.00
R8122:AW551984 UTSW 9 39599369 missense probably damaging 1.00
R8358:AW551984 UTSW 9 39599355 missense probably damaging 0.99
R8402:AW551984 UTSW 9 39597653 missense probably damaging 1.00
R8683:AW551984 UTSW 9 39599709 missense possibly damaging 0.86
R8810:AW551984 UTSW 9 39600011 missense probably damaging 1.00
R8857:AW551984 UTSW 9 39600535 missense probably damaging 1.00
R8871:AW551984 UTSW 9 39589702 nonsense probably null
R9019:AW551984 UTSW 9 39597677 nonsense probably null
Z1088:AW551984 UTSW 9 39590603 nonsense probably null
ZE80:AW551984 UTSW 9 39593667 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGAGAATAGGCCTTGGGATATCC -3'
(R):5'- GCTGAACAGAATTGTGTCCCC -3'

Sequencing Primer
(F):5'- CCTATGCACCAGGGGCC -3'
(R):5'- GCTCACTCACCTATTGCCCAG -3'
Posted On 2015-10-08