Incidental Mutation 'R3162:Wdr61'
ID349847
Institutional Source Beutler Lab
Gene Symbol Wdr61
Ensembl Gene ENSMUSG00000061559
Gene NameWD repeat domain 61
Synonyms
MMRRC Submission 040613-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R3162 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location54714735-54734519 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 54724189 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051822] [ENSMUST00000118771] [ENSMUST00000121204] [ENSMUST00000127451] [ENSMUST00000130368]
Predicted Effect probably benign
Transcript: ENSMUST00000051822
SMART Domains Protein: ENSMUSP00000056359
Gene: ENSMUSG00000061559

DomainStartEndE-ValueType
WD40 2 48 1.27e-1 SMART
WD40 53 92 7.62e-5 SMART
WD40 95 134 3.99e-1 SMART
WD40 137 176 7.73e-6 SMART
WD40 179 218 3.21e-12 SMART
WD40 221 260 8.81e-10 SMART
WD40 263 302 1.49e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118771
SMART Domains Protein: ENSMUSP00000112811
Gene: ENSMUSG00000061559

DomainStartEndE-ValueType
WD40 2 48 1.27e-1 SMART
WD40 53 92 7.62e-5 SMART
WD40 95 134 3.99e-1 SMART
WD40 137 176 7.73e-6 SMART
WD40 179 218 3.21e-12 SMART
WD40 221 260 8.81e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121204
SMART Domains Protein: ENSMUSP00000113560
Gene: ENSMUSG00000061559

DomainStartEndE-ValueType
WD40 2 48 1.27e-1 SMART
WD40 53 92 7.62e-5 SMART
WD40 95 134 3.99e-1 SMART
WD40 137 176 7.73e-6 SMART
WD40 179 218 3.21e-12 SMART
WD40 221 260 8.81e-10 SMART
WD40 263 302 1.49e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127451
SMART Domains Protein: ENSMUSP00000119362
Gene: ENSMUSG00000061559

DomainStartEndE-ValueType
WD40 5 36 5.3e1 SMART
WD40 39 78 7.73e-6 SMART
Pfam:WD40 82 107 2.8e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130368
SMART Domains Protein: ENSMUSP00000123077
Gene: ENSMUSG00000061559

DomainStartEndE-ValueType
WD40 5 36 5.3e1 SMART
WD40 39 78 7.73e-6 SMART
WD40 81 120 3.21e-12 SMART
WD40 123 162 8.81e-10 SMART
WD40 165 204 1.49e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148494
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] WDR61 is a subunit of the human PAF and SKI complexes, which function in transcriptional regulation and are involved in events downstream of RNA synthesis, such as RNA surveillance (Zhu et al., 2005 [PubMed 16024656]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933412E24Rik T A 15: 60,016,285 E102V probably damaging Het
9930014A18Rik A T 15: 60,823,447 V150E probably damaging Het
Adcy9 A G 16: 4,311,588 L715P probably damaging Het
Atad2b C A 12: 4,939,689 N133K possibly damaging Het
AW551984 C A 9: 39,593,029 R547L probably damaging Het
B3galt6 A G 4: 155,992,007 Y204H probably benign Het
Camk1g T C 1: 193,359,807 T45A possibly damaging Het
Caps2 C A 10: 112,182,486 Y180* probably null Het
Cfap54 T A 10: 93,045,278 K349N probably damaging Het
Copa T A 1: 172,091,233 C127S probably damaging Het
Dapk2 T G 9: 66,254,611 V267G probably damaging Het
Ddb1 T C 19: 10,625,971 L881P probably damaging Het
Decr1 T A 4: 15,930,972 D120V probably damaging Het
Dennd1c C T 17: 57,066,562 G637D possibly damaging Het
Dhrs3 A G 4: 144,919,446 D108G possibly damaging Het
Disp1 T C 1: 183,087,242 K1205E probably benign Het
Dusp6 T C 10: 99,264,082 Y131H probably damaging Het
Eif2b2 A T 12: 85,219,661 M34L probably benign Het
Errfi1 G A 4: 150,867,359 E415K probably damaging Het
Ext1 T C 15: 53,344,604 N254D possibly damaging Het
Gm13141 GGTTTCTTGATGCC G 4: 147,528,104 noncoding transcript Het
Hnrnpu T C 1: 178,331,125 probably benign Het
Hpx C T 7: 105,599,640 probably benign Het
Hyal3 T A 9: 107,586,806 C407S probably damaging Het
Insr T G 8: 3,161,416 N1141T possibly damaging Het
Ipo9 T C 1: 135,409,476 T174A probably benign Het
Ivd T C 2: 118,862,169 probably null Het
Leprot C T 4: 101,657,893 T89I probably damaging Het
Msh6 T C 17: 87,985,481 Y555H probably damaging Het
Nup155 G T 15: 8,148,383 R1083S possibly damaging Het
Nusap1 A T 2: 119,630,404 Q126L possibly damaging Het
Olfr1042 T C 2: 86,160,095 I92V probably benign Het
Olfr1351 C A 10: 79,017,604 T94N probably benign Het
Olfr156 T A 4: 43,820,544 K272N probably benign Het
Olfr986 G T 9: 40,187,605 Q163H probably benign Het
Pdik1l A G 4: 134,284,250 L94S probably damaging Het
Pkdrej T A 15: 85,816,617 D1706V probably damaging Het
Pkhd1l1 A G 15: 44,505,528 I856M probably damaging Het
Prkcz A T 4: 155,290,524 D114E probably benign Het
Psap T C 10: 60,277,753 L4P possibly damaging Het
Ptprk T C 10: 28,592,826 V1402A probably benign Het
Rai14 T C 15: 10,633,164 T47A possibly damaging Het
Rlf A G 4: 121,148,847 S979P probably damaging Het
Skiv2l C T 17: 34,847,813 W88* probably null Het
Srbd1 A T 17: 86,130,215 D233E probably benign Het
Tacr2 A G 10: 62,265,245 D378G probably benign Het
Taok2 A G 7: 126,875,175 I294T possibly damaging Het
Tert A G 13: 73,627,409 E93G possibly damaging Het
Tns2 A G 15: 102,113,336 E1118G possibly damaging Het
Ttc22 A T 4: 106,623,079 I177F probably damaging Het
Vmn2r86 T C 10: 130,455,804 R31G probably damaging Het
Wnt5a T C 14: 28,522,488 Y231H probably benign Het
Zw10 T C 9: 49,077,560 Y709H probably damaging Het
Other mutations in Wdr61
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Wdr61 APN 9 54728186 missense probably damaging 1.00
IGL02481:Wdr61 APN 9 54728261 missense probably damaging 1.00
IGL02483:Wdr61 APN 9 54728261 missense probably damaging 1.00
IGL03138:Wdr61 APN 9 54728163 splice site probably benign
ANU22:Wdr61 UTSW 9 54728186 missense probably damaging 1.00
R0360:Wdr61 UTSW 9 54727578 splice site probably benign
R0528:Wdr61 UTSW 9 54722935 splice site probably benign
R4609:Wdr61 UTSW 9 54728179 missense probably benign 0.28
R6554:Wdr61 UTSW 9 54727645 missense probably damaging 1.00
R7046:Wdr61 UTSW 9 54719255 missense probably damaging 1.00
X0017:Wdr61 UTSW 9 54719279 splice site probably null
Predicted Primers PCR Primer
(F):5'- CCAGCTAATCCATGCAGTGAGC -3'
(R):5'- TGGCCACAGGAACTCACATG -3'

Sequencing Primer
(F):5'- CACCACATAGGATGAGGAGTTATGC -3'
(R):5'- CACATGGGGAAAGTGAACATTTTTG -3'
Posted On2015-10-08