Incidental Mutation 'R3162:Psap'
ID349851
Institutional Source Beutler Lab
Gene Symbol Psap
Ensembl Gene ENSMUSG00000004207
Gene Nameprosaposin
SynonymsSGP-1
MMRRC Submission 040613-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3162 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location60277627-60302597 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60277753 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 4 (L4P)
Ref Sequence ENSEMBL: ENSMUSP00000101105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004316] [ENSMUST00000105465] [ENSMUST00000177779] [ENSMUST00000179238]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004316
AA Change: L4P

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000004316
Gene: ENSMUSG00000004207
AA Change: L4P

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
SAPA 21 54 1.4e-18 SMART
SapB 61 138 1.87e-27 SMART
SapB 195 272 1.2e-16 SMART
SapB 314 389 2.07e-20 SMART
low complexity region 412 430 N/A INTRINSIC
SapB 439 514 3.84e-24 SMART
SAPA 523 556 3.19e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105465
AA Change: L4P

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101105
Gene: ENSMUSG00000004207
AA Change: L4P

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
SAPA 21 54 1.4e-18 SMART
SapB 61 138 1.87e-27 SMART
SapB 195 270 2.76e-16 SMART
SapB 312 387 2.07e-20 SMART
low complexity region 410 428 N/A INTRINSIC
SapB 437 512 3.84e-24 SMART
SAPA 521 554 3.19e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177779
AA Change: L4P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000137286
Gene: ENSMUSG00000004207
AA Change: L4P

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
SAPA 21 54 1.4e-18 SMART
SapB 61 138 1.87e-27 SMART
SapB 195 273 2.37e-15 SMART
SapB 315 390 2.07e-20 SMART
low complexity region 413 431 N/A INTRINSIC
SapB 440 515 3.84e-24 SMART
SAPA 524 557 3.19e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179238
AA Change: L4P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000137476
Gene: ENSMUSG00000004207
AA Change: L4P

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
SAPA 21 54 1.4e-18 SMART
SapB 61 138 1.87e-27 SMART
SapB 195 273 8.5e-17 SMART
SapB 315 390 2.07e-20 SMART
low complexity region 413 431 N/A INTRINSIC
SapB 440 515 3.84e-24 SMART
SAPA 524 557 3.19e-22 SMART
Meta Mutation Damage Score 0.6915 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: This gene encodes a multifunctional glycoprotein that plays a role in the intracellular metabolism of various sphingolipids or secreted into the plasma, milk or cerebrospinal fluid. The encoded protein undergoes proteolytic processing to generate four different polypeptides known as saposin A, B, C or D, that are required for the hydrolysis of certain sphingolipids by lysosomal hydrolases. Alternately, the encoded protein is secreted into body fluids where it exhibits neurotrophic and myelinotrophic activities. A complete lack of the encoded protein is fatal to mice either at the neonatal stage or within the first month due to severe leukodystrophy and sphingolipid accumulation. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate the mature saposins. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for a targeted null mutation die either neonatally or around 7 weeks. At 30 days, mutants show hypomyelination, PAS-positive material in the nervous system, and accumulation of ceramides in brain, liver, and kidney. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933412E24Rik T A 15: 60,016,285 E102V probably damaging Het
9930014A18Rik A T 15: 60,823,447 V150E probably damaging Het
Adcy9 A G 16: 4,311,588 L715P probably damaging Het
Atad2b C A 12: 4,939,689 N133K possibly damaging Het
AW551984 C A 9: 39,593,029 R547L probably damaging Het
B3galt6 A G 4: 155,992,007 Y204H probably benign Het
Camk1g T C 1: 193,359,807 T45A possibly damaging Het
Caps2 C A 10: 112,182,486 Y180* probably null Het
Cfap54 T A 10: 93,045,278 K349N probably damaging Het
Copa T A 1: 172,091,233 C127S probably damaging Het
Dapk2 T G 9: 66,254,611 V267G probably damaging Het
Ddb1 T C 19: 10,625,971 L881P probably damaging Het
Decr1 T A 4: 15,930,972 D120V probably damaging Het
Dennd1c C T 17: 57,066,562 G637D possibly damaging Het
Dhrs3 A G 4: 144,919,446 D108G possibly damaging Het
Disp1 T C 1: 183,087,242 K1205E probably benign Het
Dusp6 T C 10: 99,264,082 Y131H probably damaging Het
Eif2b2 A T 12: 85,219,661 M34L probably benign Het
Errfi1 G A 4: 150,867,359 E415K probably damaging Het
Ext1 T C 15: 53,344,604 N254D possibly damaging Het
Gm13141 GGTTTCTTGATGCC G 4: 147,528,104 noncoding transcript Het
Hnrnpu T C 1: 178,331,125 probably benign Het
Hpx C T 7: 105,599,640 probably benign Het
Hyal3 T A 9: 107,586,806 C407S probably damaging Het
Insr T G 8: 3,161,416 N1141T possibly damaging Het
Ipo9 T C 1: 135,409,476 T174A probably benign Het
Ivd T C 2: 118,862,169 probably null Het
Leprot C T 4: 101,657,893 T89I probably damaging Het
Msh6 T C 17: 87,985,481 Y555H probably damaging Het
Nup155 G T 15: 8,148,383 R1083S possibly damaging Het
Nusap1 A T 2: 119,630,404 Q126L possibly damaging Het
Olfr1042 T C 2: 86,160,095 I92V probably benign Het
Olfr1351 C A 10: 79,017,604 T94N probably benign Het
Olfr156 T A 4: 43,820,544 K272N probably benign Het
Olfr986 G T 9: 40,187,605 Q163H probably benign Het
Pdik1l A G 4: 134,284,250 L94S probably damaging Het
Pkdrej T A 15: 85,816,617 D1706V probably damaging Het
Pkhd1l1 A G 15: 44,505,528 I856M probably damaging Het
Prkcz A T 4: 155,290,524 D114E probably benign Het
Ptprk T C 10: 28,592,826 V1402A probably benign Het
Rai14 T C 15: 10,633,164 T47A possibly damaging Het
Rlf A G 4: 121,148,847 S979P probably damaging Het
Skiv2l C T 17: 34,847,813 W88* probably null Het
Srbd1 A T 17: 86,130,215 D233E probably benign Het
Tacr2 A G 10: 62,265,245 D378G probably benign Het
Taok2 A G 7: 126,875,175 I294T possibly damaging Het
Tert A G 13: 73,627,409 E93G possibly damaging Het
Tns2 A G 15: 102,113,336 E1118G possibly damaging Het
Ttc22 A T 4: 106,623,079 I177F probably damaging Het
Vmn2r86 T C 10: 130,455,804 R31G probably damaging Het
Wdr61 T A 9: 54,724,189 probably benign Het
Wnt5a T C 14: 28,522,488 Y231H probably benign Het
Zw10 T C 9: 49,077,560 Y709H probably damaging Het
Other mutations in Psap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Psap APN 10 60292536 missense probably damaging 1.00
IGL01100:Psap APN 10 60299929 missense probably benign 0.03
IGL01122:Psap APN 10 60299474 missense probably benign 0.04
IGL02544:Psap APN 10 60300626 splice site probably benign
twerk UTSW 10 60300851 missense probably damaging 1.00
R0591:Psap UTSW 10 60300855 missense possibly damaging 0.65
R0624:Psap UTSW 10 60299566 splice site probably benign
R1018:Psap UTSW 10 60300811 missense probably damaging 1.00
R1896:Psap UTSW 10 60295046 nonsense probably null
R3161:Psap UTSW 10 60277753 missense possibly damaging 0.95
R3162:Psap UTSW 10 60277753 missense possibly damaging 0.95
R3615:Psap UTSW 10 60294603 missense probably benign 0.06
R3616:Psap UTSW 10 60294603 missense probably benign 0.06
R4622:Psap UTSW 10 60300851 missense probably damaging 1.00
R4623:Psap UTSW 10 60300851 missense probably damaging 1.00
R4666:Psap UTSW 10 60300545 missense probably benign
R5131:Psap UTSW 10 60299957 missense possibly damaging 0.72
R5203:Psap UTSW 10 60294975 missense probably damaging 1.00
R5251:Psap UTSW 10 60301700 missense probably damaging 0.99
R5511:Psap UTSW 10 60299180 missense possibly damaging 0.51
R5764:Psap UTSW 10 60293406 missense probably benign 0.18
R6207:Psap UTSW 10 60300538 missense probably damaging 1.00
R7003:Psap UTSW 10 60299497 missense probably damaging 1.00
R7494:Psap UTSW 10 60299496 missense probably benign 0.00
R7525:Psap UTSW 10 60299474 missense probably benign 0.04
R7711:Psap UTSW 10 60299855 missense probably damaging 0.96
R8252:Psap UTSW 10 60277689 start gained probably benign
X0019:Psap UTSW 10 60299915 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGCGCCTGACCTTGATTTAATC -3'
(R):5'- CACAGGACAAGACGTCTCTC -3'

Sequencing Primer
(F):5'- GCCTGACCTTGATTTAATCACCAG -3'
(R):5'- CCCAGTGCAGAGAATCTGG -3'
Posted On2015-10-08