Incidental Mutation 'R3162:Dusp6'
ID349855
Institutional Source Beutler Lab
Gene Symbol Dusp6
Ensembl Gene ENSMUSG00000019960
Gene Namedual specificity phosphatase 6
SynonymsPYST1, MKP-3, 1300019I03Rik, MKP3
MMRRC Submission 040613-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.557) question?
Stock #R3162 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location99263231-99267489 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99264082 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 131 (Y131H)
Ref Sequence ENSEMBL: ENSMUSP00000151438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020118] [ENSMUST00000220291]
Predicted Effect probably benign
Transcript: ENSMUST00000020118
AA Change: Y131H

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000020118
Gene: ENSMUSG00000019960
AA Change: Y131H

DomainStartEndE-ValueType
RHOD 20 145 3.06e-13 SMART
low complexity region 151 187 N/A INTRINSIC
DSPc 206 346 5.51e-65 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217893
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220218
Predicted Effect probably damaging
Transcript: ENSMUST00000220291
AA Change: Y131H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.3936 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which are associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates ERK2, is expressed in a variety of tissues with the highest levels in heart and pancreas, and unlike most other members of this family, is localized in the cytoplasm. Mutations in this gene have been associated with congenital hypogonadotropic hypogonadism. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous or heterozygous for a null mutation display partial penetrance of postnatal lethality, reduced body weight, and abnormal growth plate morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933412E24Rik T A 15: 60,016,285 E102V probably damaging Het
9930014A18Rik A T 15: 60,823,447 V150E probably damaging Het
Adcy9 A G 16: 4,311,588 L715P probably damaging Het
Atad2b C A 12: 4,939,689 N133K possibly damaging Het
AW551984 C A 9: 39,593,029 R547L probably damaging Het
B3galt6 A G 4: 155,992,007 Y204H probably benign Het
Camk1g T C 1: 193,359,807 T45A possibly damaging Het
Caps2 C A 10: 112,182,486 Y180* probably null Het
Cfap54 T A 10: 93,045,278 K349N probably damaging Het
Copa T A 1: 172,091,233 C127S probably damaging Het
Dapk2 T G 9: 66,254,611 V267G probably damaging Het
Ddb1 T C 19: 10,625,971 L881P probably damaging Het
Decr1 T A 4: 15,930,972 D120V probably damaging Het
Dennd1c C T 17: 57,066,562 G637D possibly damaging Het
Dhrs3 A G 4: 144,919,446 D108G possibly damaging Het
Disp1 T C 1: 183,087,242 K1205E probably benign Het
Eif2b2 A T 12: 85,219,661 M34L probably benign Het
Errfi1 G A 4: 150,867,359 E415K probably damaging Het
Ext1 T C 15: 53,344,604 N254D possibly damaging Het
Gm13141 GGTTTCTTGATGCC G 4: 147,528,104 noncoding transcript Het
Hnrnpu T C 1: 178,331,125 probably benign Het
Hpx C T 7: 105,599,640 probably benign Het
Hyal3 T A 9: 107,586,806 C407S probably damaging Het
Insr T G 8: 3,161,416 N1141T possibly damaging Het
Ipo9 T C 1: 135,409,476 T174A probably benign Het
Ivd T C 2: 118,862,169 probably null Het
Leprot C T 4: 101,657,893 T89I probably damaging Het
Msh6 T C 17: 87,985,481 Y555H probably damaging Het
Nup155 G T 15: 8,148,383 R1083S possibly damaging Het
Nusap1 A T 2: 119,630,404 Q126L possibly damaging Het
Olfr1042 T C 2: 86,160,095 I92V probably benign Het
Olfr1351 C A 10: 79,017,604 T94N probably benign Het
Olfr156 T A 4: 43,820,544 K272N probably benign Het
Olfr986 G T 9: 40,187,605 Q163H probably benign Het
Pdik1l A G 4: 134,284,250 L94S probably damaging Het
Pkdrej T A 15: 85,816,617 D1706V probably damaging Het
Pkhd1l1 A G 15: 44,505,528 I856M probably damaging Het
Prkcz A T 4: 155,290,524 D114E probably benign Het
Psap T C 10: 60,277,753 L4P possibly damaging Het
Ptprk T C 10: 28,592,826 V1402A probably benign Het
Rai14 T C 15: 10,633,164 T47A possibly damaging Het
Rlf A G 4: 121,148,847 S979P probably damaging Het
Skiv2l C T 17: 34,847,813 W88* probably null Het
Srbd1 A T 17: 86,130,215 D233E probably benign Het
Tacr2 A G 10: 62,265,245 D378G probably benign Het
Taok2 A G 7: 126,875,175 I294T possibly damaging Het
Tert A G 13: 73,627,409 E93G possibly damaging Het
Tns2 A G 15: 102,113,336 E1118G possibly damaging Het
Ttc22 A T 4: 106,623,079 I177F probably damaging Het
Vmn2r86 T C 10: 130,455,804 R31G probably damaging Het
Wdr61 T A 9: 54,724,189 probably benign Het
Wnt5a T C 14: 28,522,488 Y231H probably benign Het
Zw10 T C 9: 49,077,560 Y709H probably damaging Het
Other mutations in Dusp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02272:Dusp6 APN 10 99266019 missense probably damaging 1.00
IGL02687:Dusp6 APN 10 99266182 missense probably damaging 0.97
IGL02996:Dusp6 APN 10 99264766 missense possibly damaging 0.52
IGL03024:Dusp6 APN 10 99266294 missense probably damaging 0.97
R1134:Dusp6 UTSW 10 99264954 missense probably damaging 0.98
R1695:Dusp6 UTSW 10 99263693 start codon destroyed probably null 0.99
R2078:Dusp6 UTSW 10 99263824 missense probably damaging 1.00
R2899:Dusp6 UTSW 10 99263845 missense probably damaging 1.00
R3162:Dusp6 UTSW 10 99264082 missense probably damaging 1.00
R4413:Dusp6 UTSW 10 99263924 missense probably damaging 1.00
R4501:Dusp6 UTSW 10 99264595 missense probably benign 0.41
R5175:Dusp6 UTSW 10 99264002 missense possibly damaging 0.91
R5381:Dusp6 UTSW 10 99266267 missense possibly damaging 0.46
R5560:Dusp6 UTSW 10 99266241 missense probably damaging 0.97
R5820:Dusp6 UTSW 10 99264002 missense possibly damaging 0.91
R7359:Dusp6 UTSW 10 99264065 missense probably benign 0.01
R7398:Dusp6 UTSW 10 99264878 missense probably damaging 1.00
R8075:Dusp6 UTSW 10 99264948 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- ATTAATGTGGCCATCCCCGG -3'
(R):5'- CCTACCCAAAGAAAGGTGCCTG -3'

Sequencing Primer
(F):5'- ATCATGCTGCGGCGTCTG -3'
(R):5'- GAAAGGTGCCTGATTAACCCTTG -3'
Posted On2015-10-08