Mutagenetix > Incidental Mutation

Incidental Mutation 'R3162:Atad2b'

349859

Institutional Source

Beutler Lab

Gene Symbol

Atad2b

Ensembl Gene

ENSMUSG00000052812

Gene Name

ATPase family, AAA domain containing 2B

Synonyms

D530031C13Rik, 1110014E10Rik

MMRRC Submission

040613-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3162 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

4917353-5047394 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 4939689 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 133 (N133K)

Ref Sequence

ENSEMBL: ENSMUSP00000047445 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045664]

AlphaFold

E9Q166

Predicted Effect

possibly damaging
Transcript: ENSMUST00000045664
AA Change: N133K

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000047445
Gene: ENSMUSG00000052812
AA Change: N133K

Domain	Start	End	E-Value	Type
low complexity region	13	54	N/A	INTRINSIC
low complexity region	135	146	N/A	INTRINSIC
low complexity region	231	242	N/A	INTRINSIC
low complexity region	252	278	N/A	INTRINSIC
AAA	432	573	4.56e-20	SMART
SCOP:d1e32a2	771	912	3e-4	SMART
BROMO	958	1070	4.24e-20	SMART
low complexity region	1135	1144	N/A	INTRINSIC
low complexity region	1230	1253	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218303

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219187

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

98% (62/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AAA ATPase family. This family member includes an N-terminal bromodomain. It has been found to be localized to the nucleus, partly to replication sites, consistent with a chromatin-related function. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit reduced body size and fertility in female mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933412E24Rik	T	A	15: 60,016,285	E102V	probably damaging	Het
9930014A18Rik	A	T	15: 60,823,447	V150E	probably damaging	Het
Adcy9	A	G	16: 4,311,588	L715P	probably damaging	Het
AW551984	C	A	9: 39,593,029	R547L	probably damaging	Het
B3galt6	A	G	4: 155,992,007	Y204H	probably benign	Het
Camk1g	T	C	1: 193,359,807	T45A	possibly damaging	Het
Caps2	C	A	10: 112,182,486	Y180*	probably null	Het
Cfap54	T	A	10: 93,045,278	K349N	probably damaging	Het
Copa	T	A	1: 172,091,233	C127S	probably damaging	Het
Dapk2	T	G	9: 66,254,611	V267G	probably damaging	Het
Ddb1	T	C	19: 10,625,971	L881P	probably damaging	Het
Decr1	T	A	4: 15,930,972	D120V	probably damaging	Het
Dennd1c	C	T	17: 57,066,562	G637D	possibly damaging	Het
Dhrs3	A	G	4: 144,919,446	D108G	possibly damaging	Het
Disp1	T	C	1: 183,087,242	K1205E	probably benign	Het
Dusp6	T	C	10: 99,264,082	Y131H	probably damaging	Het
Eif2b2	A	T	12: 85,219,661	M34L	probably benign	Het
Errfi1	G	A	4: 150,867,359	E415K	probably damaging	Het
Ext1	T	C	15: 53,344,604	N254D	possibly damaging	Het
Gm13141	GGTTTCTTGATGCC	G	4: 147,528,104		noncoding transcript	Het
Hnrnpu	T	C	1: 178,331,125		probably benign	Het
Hpx	C	T	7: 105,599,640		probably benign	Het
Hyal3	T	A	9: 107,586,806	C407S	probably damaging	Het
Insr	T	G	8: 3,161,416	N1141T	possibly damaging	Het
Ipo9	T	C	1: 135,409,476	T174A	probably benign	Het
Ivd	T	C	2: 118,862,169		probably null	Het
Leprot	C	T	4: 101,657,893	T89I	probably damaging	Het
Msh6	T	C	17: 87,985,481	Y555H	probably damaging	Het
Nup155	G	T	15: 8,148,383	R1083S	possibly damaging	Het
Nusap1	A	T	2: 119,630,404	Q126L	possibly damaging	Het
Olfr1042	T	C	2: 86,160,095	I92V	probably benign	Het
Olfr1351	C	A	10: 79,017,604	T94N	probably benign	Het
Olfr156	T	A	4: 43,820,544	K272N	probably benign	Het
Olfr986	G	T	9: 40,187,605	Q163H	probably benign	Het
Pdik1l	A	G	4: 134,284,250	L94S	probably damaging	Het
Pkdrej	T	A	15: 85,816,617	D1706V	probably damaging	Het
Pkhd1l1	A	G	15: 44,505,528	I856M	probably damaging	Het
Prkcz	A	T	4: 155,290,524	D114E	probably benign	Het
Psap	T	C	10: 60,277,753	L4P	possibly damaging	Het
Ptprk	T	C	10: 28,592,826	V1402A	probably benign	Het
Rai14	T	C	15: 10,633,164	T47A	possibly damaging	Het
Rlf	A	G	4: 121,148,847	S979P	probably damaging	Het
Skiv2l	C	T	17: 34,847,813	W88*	probably null	Het
Srbd1	A	T	17: 86,130,215	D233E	probably benign	Het
Tacr2	A	G	10: 62,265,245	D378G	probably benign	Het
Taok2	A	G	7: 126,875,175	I294T	possibly damaging	Het
Tert	A	G	13: 73,627,409	E93G	possibly damaging	Het
Tns2	A	G	15: 102,113,336	E1118G	possibly damaging	Het
Ttc22	A	T	4: 106,623,079	I177F	probably damaging	Het
Vmn2r86	T	C	10: 130,455,804	R31G	probably damaging	Het
Wdr61	T	A	9: 54,724,189		probably benign	Het
Wnt5a	T	C	14: 28,522,488	Y231H	probably benign	Het
Zw10	T	C	9: 49,077,560	Y709H	probably damaging	Het

Other mutations in Atad2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Atad2b	APN	12	5024593	missense	probably damaging	1.00
IGL00917:Atad2b	APN	12	4965837	unclassified	probably benign
IGL01011:Atad2b	APN	12	4965984	missense	probably benign	0.01
IGL01092:Atad2b	APN	12	5017987	missense	probably damaging	0.98
IGL01604:Atad2b	APN	12	4965837	unclassified	probably benign
IGL01924:Atad2b	APN	12	5034093	missense	probably damaging	1.00
IGL02197:Atad2b	APN	12	5018056	missense	possibly damaging	0.84
IGL02397:Atad2b	APN	12	4974046	missense	probably damaging	1.00
IGL02404:Atad2b	APN	12	4941972	missense	probably benign	0.08
IGL02517:Atad2b	APN	12	5018037	missense	probably benign	0.07
IGL02726:Atad2b	APN	12	4974003	nonsense	probably null
IGL02896:Atad2b	APN	12	4958151	missense	probably damaging	1.00
IGL03227:Atad2b	APN	12	5006715	missense	probably damaging	1.00
IGL03265:Atad2b	APN	12	5024628	missense	probably benign	0.24
Plyers	UTSW	12	4973970	missense	probably damaging	1.00
Smidge	UTSW	12	4990949	missense	probably damaging	1.00
Tensor	UTSW	12	4957558	missense	probably damaging	1.00
Traction	UTSW	12	5027182	critical splice donor site	probably null
Vice	UTSW	12	5018002	missense	probably damaging	1.00
K3955:Atad2b	UTSW	12	4954536	splice site	probably benign
P0038:Atad2b	UTSW	12	4954536	splice site	probably benign
PIT4418001:Atad2b	UTSW	12	5024587	missense	probably benign	0.07
PIT4431001:Atad2b	UTSW	12	5031795	missense	possibly damaging	0.77
R0006:Atad2b	UTSW	12	4942030	missense	possibly damaging	0.81
R0006:Atad2b	UTSW	12	4942030	missense	possibly damaging	0.81
R0124:Atad2b	UTSW	12	4952676	missense	probably benign	0.23
R0462:Atad2b	UTSW	12	4941973	missense	possibly damaging	0.79
R0483:Atad2b	UTSW	12	4945035	splice site	probably benign
R0617:Atad2b	UTSW	12	4937401	missense	probably benign	0.43
R0894:Atad2b	UTSW	12	4965915	missense	probably damaging	1.00
R0942:Atad2b	UTSW	12	5024591	missense	probably damaging	1.00
R0960:Atad2b	UTSW	12	5006593	splice site	probably benign
R0973:Atad2b	UTSW	12	5031784	missense	probably benign	0.00
R1306:Atad2b	UTSW	12	4974239	missense	probably benign	0.08
R1530:Atad2b	UTSW	12	4942018	nonsense	probably null
R1678:Atad2b	UTSW	12	4965899	missense	possibly damaging	0.91
R1689:Atad2b	UTSW	12	5034575	nonsense	probably null
R1826:Atad2b	UTSW	12	4974094	missense	probably benign	0.00
R1996:Atad2b	UTSW	12	4990883	missense	probably benign	0.01
R2233:Atad2b	UTSW	12	5006745	missense	probably damaging	1.00
R2235:Atad2b	UTSW	12	5006745	missense	probably damaging	1.00
R2943:Atad2b	UTSW	12	4942067	missense	probably damaging	0.98
R3161:Atad2b	UTSW	12	4939689	missense	possibly damaging	0.87
R3162:Atad2b	UTSW	12	4939689	missense	possibly damaging	0.87
R3508:Atad2b	UTSW	12	4950595	critical splice donor site	probably null
R4239:Atad2b	UTSW	12	4985710	missense	probably benign	0.05
R4401:Atad2b	UTSW	12	4940145	missense	probably damaging	0.99
R4558:Atad2b	UTSW	12	4943223	missense	probably benign	0.10
R4559:Atad2b	UTSW	12	4943223	missense	probably benign	0.10
R4573:Atad2b	UTSW	12	4954663	splice site	probably null
R4639:Atad2b	UTSW	12	5018053	missense	probably damaging	1.00
R4847:Atad2b	UTSW	12	4944901	splice site	probably null
R4850:Atad2b	UTSW	12	4943251	missense	probably benign	0.15
R4851:Atad2b	UTSW	12	4943251	missense	probably benign	0.15
R4979:Atad2b	UTSW	12	5034513	missense	probably damaging	1.00
R5024:Atad2b	UTSW	12	4937534	missense	probably benign	0.45
R5305:Atad2b	UTSW	12	4965855	missense	probably damaging	1.00
R5405:Atad2b	UTSW	12	4940098	missense	possibly damaging	0.87
R5627:Atad2b	UTSW	12	4917911	missense	probably benign	0.01
R5754:Atad2b	UTSW	12	5010351	missense	probably benign	0.01
R6163:Atad2b	UTSW	12	4954593	missense	probably benign	0.00
R6371:Atad2b	UTSW	12	4973970	missense	probably damaging	1.00
R6374:Atad2b	UTSW	12	5018002	missense	probably damaging	1.00
R6399:Atad2b	UTSW	12	4957558	missense	probably damaging	1.00
R6433:Atad2b	UTSW	12	4952642	missense	possibly damaging	0.89
R6546:Atad2b	UTSW	12	4990949	missense	probably damaging	1.00
R6617:Atad2b	UTSW	12	5024668	missense	probably benign	0.00
R7199:Atad2b	UTSW	12	5017992	missense	probably damaging	1.00
R7267:Atad2b	UTSW	12	5027105	nonsense	probably null
R7405:Atad2b	UTSW	12	4943232	missense	probably benign	0.08
R7460:Atad2b	UTSW	12	4952660	missense	probably benign	0.28
R7568:Atad2b	UTSW	12	5010390	critical splice donor site	probably null
R7593:Atad2b	UTSW	12	5031726	missense	probably benign	0.16
R7648:Atad2b	UTSW	12	5027182	critical splice donor site	probably null
R8253:Atad2b	UTSW	12	4974159	missense	possibly damaging	0.54
R8253:Atad2b	UTSW	12	4974160	missense	probably benign	0.02
R8708:Atad2b	UTSW	12	4961253	missense	probably damaging	1.00
R8894:Atad2b	UTSW	12	5014001	critical splice donor site	probably null
R8948:Atad2b	UTSW	12	4991012	missense	possibly damaging	0.87
R8976:Atad2b	UTSW	12	4917923	critical splice donor site	probably null
R9052:Atad2b	UTSW	12	4965982	missense	probably damaging	1.00
R9057:Atad2b	UTSW	12	5018102	nonsense	probably null
R9134:Atad2b	UTSW	12	5010351	missense	probably benign	0.01
R9450:Atad2b	UTSW	12	5013859	missense	probably benign	0.06
R9453:Atad2b	UTSW	12	5031578	missense	probably benign	0.13
R9494:Atad2b	UTSW	12	5031852	missense	probably benign	0.26
R9634:Atad2b	UTSW	12	5010332	missense	probably damaging	1.00
R9764:Atad2b	UTSW	12	5032064	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACGGTCTTGGTTAAATTTATGCTGC -3'
(R):5'- GCTGTGCAGGAGAACCATAG -3'

Sequencing Primer
(F):5'- CAATTGACAGCAACATTAATTCAGC -3'
(R):5'- AACCATAGTTCAATCTCTAGTTCCC -3'

Posted On

2015-10-08