Incidental Mutation 'R0267:Steap2'
ID34986
Institutional Source Beutler Lab
Gene Symbol Steap2
Ensembl Gene ENSMUSG00000015653
Gene Namesix transmembrane epithelial antigen of prostate 2
Synonyms
MMRRC Submission 038493-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0267 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location5664829-5694578 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 5673561 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 440 (I440F)
Ref Sequence ENSEMBL: ENSMUSP00000132501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015797] [ENSMUST00000115424] [ENSMUST00000115425] [ENSMUST00000115426] [ENSMUST00000115427] [ENSMUST00000148333] [ENSMUST00000164219]
Predicted Effect probably benign
Transcript: ENSMUST00000015797
AA Change: I440F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000015797
Gene: ENSMUSG00000015653
AA Change: I440F

DomainStartEndE-ValueType
Pfam:F420_oxidored 31 118 8.9e-19 PFAM
transmembrane domain 209 231 N/A INTRINSIC
Pfam:Ferric_reduct 258 405 2.8e-16 PFAM
transmembrane domain 431 453 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115424
AA Change: I440F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000111084
Gene: ENSMUSG00000015653
AA Change: I440F

DomainStartEndE-ValueType
Pfam:F420_oxidored 31 118 4e-18 PFAM
transmembrane domain 209 231 N/A INTRINSIC
Pfam:Ferric_reduct 258 406 1.5e-22 PFAM
transmembrane domain 431 453 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115425
AA Change: I440F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000111085
Gene: ENSMUSG00000015653
AA Change: I440F

DomainStartEndE-ValueType
Pfam:F420_oxidored 31 118 4e-18 PFAM
transmembrane domain 209 231 N/A INTRINSIC
Pfam:Ferric_reduct 258 406 1.5e-22 PFAM
transmembrane domain 431 453 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115426
AA Change: I440F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000111086
Gene: ENSMUSG00000015653
AA Change: I440F

DomainStartEndE-ValueType
Pfam:F420_oxidored 31 118 4e-18 PFAM
transmembrane domain 209 231 N/A INTRINSIC
Pfam:Ferric_reduct 258 406 1.5e-22 PFAM
transmembrane domain 431 453 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115427
SMART Domains Protein: ENSMUSP00000111087
Gene: ENSMUSG00000015653

DomainStartEndE-ValueType
Pfam:F420_oxidored 31 118 2.3e-17 PFAM
transmembrane domain 209 231 N/A INTRINSIC
Pfam:Ferric_reduct 258 401 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148333
AA Change: I440F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000116910
Gene: ENSMUSG00000015653
AA Change: I440F

DomainStartEndE-ValueType
Pfam:F420_oxidored 31 118 8.3e-18 PFAM
transmembrane domain 209 231 N/A INTRINSIC
Pfam:Ferric_reduct 258 406 2.7e-22 PFAM
transmembrane domain 431 453 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149412
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150238
Predicted Effect probably benign
Transcript: ENSMUST00000164219
AA Change: I440F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000132501
Gene: ENSMUSG00000015653
AA Change: I440F

DomainStartEndE-ValueType
Pfam:F420_oxidored 31 118 4e-18 PFAM
transmembrane domain 209 231 N/A INTRINSIC
Pfam:Ferric_reduct 258 406 1.5e-22 PFAM
transmembrane domain 431 453 N/A INTRINSIC
Meta Mutation Damage Score 0.1022 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.7%
  • 10x: 96.2%
  • 20x: 94.0%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the STEAP family and encodes a multi-pass membrane protein that localizes to the Golgi complex, the plasma membrane, and the vesicular tubular structures in the cytosol. A highly similar protein in mouse has both ferrireductase and cupric reductase activity, and stimulates the cellular uptake of both iron and copper in vitro. Increased transcriptional expression of the human gene is associated with prostate cancer progression. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,046,105 F1721S probably damaging Het
Adgrb1 G A 15: 74,529,389 R78H probably damaging Het
Adgrd1 G A 5: 129,139,594 A342T probably benign Het
Adrb1 A T 19: 56,723,491 K374* probably null Het
Aldh18a1 C A 19: 40,573,789 V264F probably benign Het
Aldh1l2 C T 10: 83,522,687 probably benign Het
Alox15 T A 11: 70,346,153 H393L probably damaging Het
Aox2 A G 1: 58,339,446 probably benign Het
Appbp2 T C 11: 85,201,462 Y297C probably damaging Het
Atxn2l T G 7: 126,493,207 Q950P probably damaging Het
Bicd1 A T 6: 149,517,042 D737V probably damaging Het
C9 T C 15: 6,467,458 I212T probably benign Het
Ccdc63 A T 5: 122,117,044 probably benign Het
Chst1 C A 2: 92,613,606 P141Q probably damaging Het
Cped1 T A 6: 22,119,476 F311L probably damaging Het
D6Wsu163e T A 6: 126,946,491 H113Q probably benign Het
Dcn A T 10: 97,506,483 probably benign Het
Dmbx1 C T 4: 115,918,112 A324T probably benign Het
Dock10 G T 1: 80,512,454 Q1618K probably damaging Het
Dpyd A G 3: 118,917,272 E443G probably benign Het
Espl1 T C 15: 102,313,017 V953A possibly damaging Het
Exosc10 T C 4: 148,562,756 L174P probably damaging Het
Foxg1 A G 12: 49,385,582 Y366C probably damaging Het
Fxyd3 T C 7: 31,070,734 probably benign Het
Gbp2 T C 3: 142,630,106 V189A probably benign Het
Gins4 T C 8: 23,229,410 probably benign Het
Gm12789 A G 4: 101,988,122 T3A probably benign Het
Gnb1l T C 16: 18,548,089 probably benign Het
Gtpbp3 T C 8: 71,491,497 L295S probably damaging Het
Hrh4 C A 18: 13,022,398 Y331* probably null Het
Hsd11b1 A T 1: 193,241,397 Y52N probably damaging Het
Jam3 A G 9: 27,106,405 I29T probably benign Het
Kctd16 T A 18: 40,530,877 I353N probably benign Het
Lama4 G T 10: 39,028,639 G246C probably damaging Het
Lhx3 T A 2: 26,203,028 M137L probably benign Het
Morc2a T C 11: 3,678,567 I340T probably benign Het
Myo7a A C 7: 98,054,624 I1969S probably benign Het
Olfr1471 T A 19: 13,445,428 C139S probably damaging Het
Olfr304 T C 7: 86,386,267 E131G possibly damaging Het
Olfr429 A G 1: 174,089,166 N42S probably damaging Het
Pclo T C 5: 14,681,180 L3232P unknown Het
Polr1a T G 6: 71,974,139 I1407M probably damaging Het
Ppip5k2 A G 1: 97,728,997 V817A probably damaging Het
Rbfox3 T C 11: 118,495,240 T280A probably benign Het
Rfx3 T C 19: 27,793,788 D521G probably benign Het
Scn5a C T 9: 119,543,135 V223I probably damaging Het
Sgsm3 T G 15: 81,006,602 M119R probably damaging Het
Slc6a7 T A 18: 60,996,711 M608L probably benign Het
Slit2 A G 5: 48,182,331 probably benign Het
Syn2 T G 6: 115,254,150 probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tfb2m G A 1: 179,533,638 H262Y probably benign Het
Trmt1l A G 1: 151,457,675 probably benign Het
Trpm6 C A 19: 18,823,378 P819T probably benign Het
Ttn G A 2: 76,743,689 A25620V probably damaging Het
Ubn2 T C 6: 38,482,618 probably null Het
Vars T C 17: 35,011,596 probably benign Het
Vip A T 10: 5,644,004 D119V possibly damaging Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Vps33b T C 7: 80,286,054 I405T possibly damaging Het
Zbtb21 T A 16: 97,952,100 S356C probably damaging Het
Zdhhc6 A T 19: 55,308,930 S237T probably benign Het
Zfp142 G A 1: 74,576,064 A427V probably benign Het
Zfp692 T A 11: 58,314,314 V463E possibly damaging Het
Zmynd8 A T 2: 165,828,402 I384N probably damaging Het
Other mutations in Steap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02052:Steap2 APN 5 5673586 missense probably damaging 0.99
IGL02272:Steap2 APN 5 5677612 missense probably benign 0.10
IGL02680:Steap2 APN 5 5673474 missense probably benign 0.00
R1670:Steap2 UTSW 5 5677393 missense possibly damaging 0.80
R2175:Steap2 UTSW 5 5673501 missense probably damaging 1.00
R2188:Steap2 UTSW 5 5673643 nonsense probably null
R2374:Steap2 UTSW 5 5675845 missense probably damaging 0.99
R4902:Steap2 UTSW 5 5675866 missense possibly damaging 0.91
R4941:Steap2 UTSW 5 5677651 missense probably damaging 1.00
R5012:Steap2 UTSW 5 5677784 missense possibly damaging 0.48
R5555:Steap2 UTSW 5 5677544 missense possibly damaging 0.89
R5571:Steap2 UTSW 5 5675912 missense probably damaging 1.00
R5666:Steap2 UTSW 5 5673681 missense probably benign 0.00
R5670:Steap2 UTSW 5 5673681 missense probably benign 0.00
R5677:Steap2 UTSW 5 5677497 nonsense probably null
R6101:Steap2 UTSW 5 5675891 missense possibly damaging 0.71
R6105:Steap2 UTSW 5 5675891 missense possibly damaging 0.71
R6190:Steap2 UTSW 5 5675881 missense probably damaging 1.00
R7172:Steap2 UTSW 5 5682896 missense possibly damaging 0.52
R7576:Steap2 UTSW 5 5677406 missense probably benign 0.01
R7706:Steap2 UTSW 5 5682967 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGCACCTCTTGTCATCACATCACTG -3'
(R):5'- TGCAACTGCCTTAAATTGCCCAATTC -3'

Sequencing Primer
(F):5'- TGTCATCACATCACTGTGACC -3'
(R):5'- TTGCCCAATTCAGAAGACAGTAG -3'
Posted On2013-05-09