Incidental Mutation 'R4679:Fmn2'
ID349882
Institutional Source Beutler Lab
Gene Symbol Fmn2
Ensembl Gene ENSMUSG00000028354
Gene Nameformin 2
Synonyms
MMRRC Submission 041932-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.718) question?
Stock #R4679 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location174501825-174822729 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 174503162 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 373 (S373P)
Ref Sequence ENSEMBL: ENSMUSP00000030039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030039]
Predicted Effect unknown
Transcript: ENSMUST00000030039
AA Change: S373P
SMART Domains Protein: ENSMUSP00000030039
Gene: ENSMUSG00000028354
AA Change: S373P

DomainStartEndE-ValueType
low complexity region 35 69 N/A INTRINSIC
low complexity region 196 212 N/A INTRINSIC
low complexity region 304 334 N/A INTRINSIC
Blast:FH2 353 577 2e-97 BLAST
low complexity region 604 616 N/A INTRINSIC
coiled coil region 645 681 N/A INTRINSIC
Blast:FH2 710 788 2e-14 BLAST
low complexity region 796 831 N/A INTRINSIC
Pfam:Drf_FH1 942 1048 3.1e-16 PFAM
low complexity region 1117 1131 N/A INTRINSIC
FH2 1139 1543 1.29e-85 SMART
PDB:2YLE|B 1550 1578 4e-11 PDB
Meta Mutation Damage Score 0.0733 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 98% (112/114)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the formin homology protein family. The encoded protein is thought to have essential roles in organization of the actin cytoskeleton and in cell polarity. Mutations in this gene have been associated with mental retardation autosomal recessive 47 (MRT47). Alternatively spliced transcript variants have been identified. [provided by RefSeq, Mar 2015]
PHENOTYPE: Female mice homozygous for a knock-out allele display polyploid embryo formation, recurrent pregnancy loss, hypofertility, and inadequate nursing behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik C T 4: 35,226,033 probably benign Het
AA986860 T A 1: 130,742,403 S121T possibly damaging Het
Abcb9 A G 5: 124,078,804 V450A probably benign Het
Abcg1 A T 17: 31,114,261 R659S probably benign Het
Acad9 A T 3: 36,088,840 N508I possibly damaging Het
Acrbp T A 6: 125,060,918 C393S probably damaging Het
Adcy7 T C 8: 88,317,937 V486A probably benign Het
Adgrf1 G T 17: 43,310,493 L540F probably damaging Het
Ap5m1 T C 14: 49,078,828 I285T probably benign Het
Arhgap27 G T 11: 103,360,949 probably benign Het
Armc5 A T 7: 128,240,104 E198V possibly damaging Het
Atp8b5 A T 4: 43,365,955 K742M probably benign Het
Atp9a T G 2: 168,661,964 T603P possibly damaging Het
Bsn A G 9: 108,110,130 S2808P unknown Het
Catsper4 T C 4: 134,226,605 N81S probably damaging Het
Ccl17 C G 8: 94,810,500 T10S probably benign Het
Cdc123 A T 2: 5,844,892 V6D probably damaging Het
Cdca2 T C 14: 67,714,966 K14E possibly damaging Het
Cdh3 C A 8: 106,539,856 T302K probably damaging Het
Cdh9 A G 15: 16,850,959 M605V probably benign Het
Cdk4 A G 10: 127,064,911 E144G possibly damaging Het
Clasp1 C T 1: 118,543,271 A879V probably damaging Het
Cldn8 G A 16: 88,562,408 H210Y probably benign Het
Cntn5 T C 9: 9,970,531 D518G probably benign Het
Cog1 C T 11: 113,652,290 A208V probably damaging Het
Col4a2 T A 8: 11,431,337 H836Q possibly damaging Het
Copb1 T C 7: 114,248,976 D108G probably damaging Het
Csmd3 A T 15: 48,161,083 Y600* probably null Het
Cyb5r1 T A 1: 134,407,833 H164Q probably benign Het
Dkc1 A G X: 75,100,992 I215V probably benign Het
Enpep A G 3: 129,303,713 probably null Het
Fam71b T A 11: 46,404,813 M4K possibly damaging Het
Fbln7 A G 2: 128,894,886 Y311C probably damaging Het
Fign A C 2: 63,979,261 L555R probably damaging Het
Fkbp7 A T 2: 76,671,688 probably benign Het
Frmd4b C T 6: 97,295,666 D868N possibly damaging Het
Gfpt2 A G 11: 49,823,737 N321S probably benign Het
Glmn G T 5: 107,561,075 T372K probably damaging Het
Gm26602 C T 10: 79,910,974 probably benign Het
Gm6797 A G X: 8,639,694 noncoding transcript Het
Gpat3 T A 5: 100,893,456 F383L probably damaging Het
Grrp1 A G 4: 134,251,436 S244P probably damaging Het
H2-M11 C T 17: 36,548,150 T194I possibly damaging Het
Hcn1 C T 13: 117,657,015 H268Y probably benign Het
Hectd4 G T 5: 121,325,251 C2345F possibly damaging Het
Htt A G 5: 34,820,080 D770G probably benign Het
Ints3 T C 3: 90,408,510 T316A possibly damaging Het
Ipo9 A G 1: 135,394,169 F608L probably benign Het
Irak1 A C X: 74,022,389 probably benign Het
Jam2 G A 16: 84,812,952 V151M probably damaging Het
Lag3 T A 6: 124,904,545 Q488L possibly damaging Het
Large2 A T 2: 92,367,558 L266Q probably benign Het
Lrp3 T G 7: 35,203,940 D327A probably damaging Het
Mamstr C A 7: 45,644,692 probably benign Het
Mettl14 G A 3: 123,369,414 probably benign Het
Miga1 A G 3: 152,322,475 V139A probably damaging Het
Mthfd2l A C 5: 90,948,911 R130S probably benign Het
Myo1b A G 1: 51,757,973 I970T possibly damaging Het
Nat10 C A 2: 103,732,170 W607L probably damaging Het
Nop56 A G 2: 130,278,273 T183A probably benign Het
Olfr1258 A G 2: 89,930,664 Y285C possibly damaging Het
Olfr239 A G 17: 33,199,393 H115R probably benign Het
Olfr291 T A 7: 84,856,904 Y178* probably null Het
Olfr464 T A 11: 87,914,310 M199L probably benign Het
Olfr592 A G 7: 103,187,102 Y167C probably benign Het
Olfr710 A T 7: 106,944,945 S19T probably benign Het
Pcdhb12 T C 18: 37,436,949 F383L probably damaging Het
Pde4dip C A 3: 97,695,005 D2252Y probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Plscr2 T G 9: 92,287,770 L91R probably benign Het
Plxnc1 T A 10: 94,794,444 Y1531F probably damaging Het
Ptprq A T 10: 107,685,182 F710I probably benign Het
Rad51ap2 A G 12: 11,456,551 E158G probably damaging Het
Rasip1 T A 7: 45,627,823 H18Q possibly damaging Het
Rcsd1 T A 1: 165,655,924 N166I probably damaging Het
Ripor1 T A 8: 105,617,785 I517K possibly damaging Het
Ryr2 T A 13: 11,824,369 H506L probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sept14 T C 5: 129,693,026 D202G possibly damaging Het
Siglec1 A T 2: 131,073,411 L1420Q possibly damaging Het
Slc22a29 T A 19: 8,161,584 I505F possibly damaging Het
Sorcs1 T A 19: 50,182,669 Y927F probably benign Het
Spats2 T G 15: 99,180,722 M191R possibly damaging Het
Sycp1 C T 3: 102,922,462 probably null Het
T2 A G 17: 8,391,016 E99G possibly damaging Het
Taf3 G A 2: 10,048,564 probably benign Het
Tnfsf10 A T 3: 27,335,579 N263I probably damaging Het
Treml2 A T 17: 48,308,175 R229S probably benign Het
Trmt13 T C 3: 116,589,755 K125E probably damaging Het
Ttc9 G T 12: 81,631,601 C66F probably damaging Het
Vmn2r63 C T 7: 42,928,120 M331I probably benign Het
Zfp353-ps T C 8: 42,082,214 noncoding transcript Het
Zfp932 A T 5: 110,009,894 H486L probably damaging Het
Other mutations in Fmn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Fmn2 APN 1 174503319 missense unknown
IGL01085:Fmn2 APN 1 174695654 missense probably damaging 1.00
IGL01784:Fmn2 APN 1 174502428 missense unknown
IGL02095:Fmn2 APN 1 174502601 missense unknown
IGL02330:Fmn2 APN 1 174609945 missense probably benign 0.38
IGL02552:Fmn2 APN 1 174695720 missense probably damaging 1.00
IGL02835:Fmn2 UTSW 1 174582059 missense unknown
PIT4498001:Fmn2 UTSW 1 174612604 missense probably damaging 1.00
PIT4677001:Fmn2 UTSW 1 174647133 missense probably damaging 1.00
R0025:Fmn2 UTSW 1 174791314 missense probably damaging 1.00
R0062:Fmn2 UTSW 1 174608449 unclassified probably benign
R0062:Fmn2 UTSW 1 174608449 unclassified probably benign
R0306:Fmn2 UTSW 1 174609484 unclassified probably benign
R0325:Fmn2 UTSW 1 174609954 critical splice donor site probably null
R0403:Fmn2 UTSW 1 174694278 missense probably damaging 1.00
R0491:Fmn2 UTSW 1 174581959 missense unknown
R0898:Fmn2 UTSW 1 174503460 missense unknown
R1202:Fmn2 UTSW 1 174612535 nonsense probably null
R1719:Fmn2 UTSW 1 174608458 unclassified probably benign
R1763:Fmn2 UTSW 1 174502266 missense unknown
R1771:Fmn2 UTSW 1 174608776 unclassified probably benign
R1777:Fmn2 UTSW 1 174581922 missense unknown
R1831:Fmn2 UTSW 1 174609945 missense probably benign 0.38
R2259:Fmn2 UTSW 1 174502932 missense unknown
R2960:Fmn2 UTSW 1 174609819 missense probably damaging 1.00
R3545:Fmn2 UTSW 1 174502626 missense unknown
R3840:Fmn2 UTSW 1 174582033 frame shift probably null
R4207:Fmn2 UTSW 1 174581955 missense unknown
R4779:Fmn2 UTSW 1 174609895 missense probably damaging 1.00
R4887:Fmn2 UTSW 1 174581961 missense unknown
R4926:Fmn2 UTSW 1 174502415 missense unknown
R5007:Fmn2 UTSW 1 174744300 missense probably damaging 1.00
R5247:Fmn2 UTSW 1 174821228 missense probably benign 0.04
R5324:Fmn2 UTSW 1 174608880 unclassified probably benign
R5353:Fmn2 UTSW 1 174503006 missense unknown
R5420:Fmn2 UTSW 1 174698778 nonsense probably null
R5607:Fmn2 UTSW 1 174609811 missense probably damaging 0.97
R5668:Fmn2 UTSW 1 174582037 missense unknown
R5982:Fmn2 UTSW 1 174502453 missense unknown
R6148:Fmn2 UTSW 1 174666663 missense probably damaging 1.00
R6324:Fmn2 UTSW 1 174612553 missense possibly damaging 0.87
R6466:Fmn2 UTSW 1 174609583 unclassified probably benign
R6647:Fmn2 UTSW 1 174593104 missense unknown
R6835:Fmn2 UTSW 1 174699669 missense probably damaging 1.00
R7231:Fmn2 UTSW 1 174609203 unclassified probably benign
R7340:Fmn2 UTSW 1 174609203 unclassified probably benign
R7378:Fmn2 UTSW 1 174609203 unclassified probably benign
R7457:Fmn2 UTSW 1 174503737 splice site probably null
R7474:Fmn2 UTSW 1 174609203 unclassified probably benign
R7564:Fmn2 UTSW 1 174609574 missense unknown
R7582:Fmn2 UTSW 1 174698790 missense probably damaging 1.00
R7748:Fmn2 UTSW 1 174666649 missense probably damaging 1.00
R7832:Fmn2 UTSW 1 174609203 unclassified probably benign
R8035:Fmn2 UTSW 1 174719871 missense probably damaging 1.00
R8203:Fmn2 UTSW 1 174609203 unclassified probably benign
R8343:Fmn2 UTSW 1 174609203 unclassified probably benign
R8371:Fmn2 UTSW 1 174609607 missense unknown
R8377:Fmn2 UTSW 1 174608445 nonsense probably null
R8543:Fmn2 UTSW 1 174609203 unclassified probably benign
RF010:Fmn2 UTSW 1 174582015 missense unknown
Z1176:Fmn2 UTSW 1 174608394 missense unknown
Predicted Primers PCR Primer
(F):5'- AGACACCAGGTTATGCGACC -3'
(R):5'- ACGTTCTGAAAGCCATCAGC -3'

Sequencing Primer
(F):5'- AGCCTTCACCTTTCCGGAG -3'
(R):5'- ACTGTCATCCGCAGTAGCC -3'
Posted On2015-10-08