Mutagenetix > Incidental Mutations

Incidental Mutation 'R4679:Siglec1'

349893

Institutional Source

Beutler Lab

Gene Symbol

Siglec1

Ensembl Gene

ENSMUSG00000027322

Gene Name

sialic acid binding Ig-like lectin 1, sialoadhesin

Synonyms

Sn, CD169, Siglec-1

MMRRC Submission

041932-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.074) question?

Stock #

R4679 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

131069220-131086765 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 131073411 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 1420 (L1420Q)

Ref Sequence

ENSEMBL: ENSMUSP00000105856 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028794] [ENSMUST00000110227]

Predicted Effect

probably benign
Transcript: ENSMUST00000028794
AA Change: L1420Q

PolyPhen 2 Score 0.421 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000028794
Gene: ENSMUSG00000027322
AA Change: L1420Q

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
IG	32	142	2.92e-5	SMART
Pfam:C2-set_2	148	235	9.4e-18	PFAM
IGc2	260	319	8.78e-9	SMART
IGc2	344	404	4.07e-4	SMART
IGc2	431	505	3.3e-4	SMART
IGc2	529	589	5.75e-4	SMART
IGc2	622	698	3.54e-4	SMART
low complexity region	700	705	N/A	INTRINSIC
IG	716	795	3.35e-5	SMART
IG	804	896	6.51e-3	SMART
IGc2	909	969	4.13e-5	SMART
IG_like	1001	1076	6.78e-2	SMART
low complexity region	1077	1088	N/A	INTRINSIC
IG	1094	1171	4.32e-8	SMART
IG_like	1185	1250	1.94e-2	SMART
IG	1268	1345	1.36e-5	SMART
IG_like	1354	1447	1.45e1	SMART
IG_like	1365	1435	4.51e-2	SMART
IG	1454	1534	4.56e-7	SMART
IG_like	1549	1624	1.21e-1	SMART
transmembrane domain	1647	1669	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110227
AA Change: L1420Q

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000105856
Gene: ENSMUSG00000027322
AA Change: L1420Q

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
IG	32	142	2.92e-5	SMART
Pfam:C2-set_2	148	235	7e-17	PFAM
IGc2	260	319	8.78e-9	SMART
IGc2	344	404	4.07e-4	SMART
IGc2	431	505	3.3e-4	SMART
IGc2	529	589	5.75e-4	SMART
IGc2	622	698	3.54e-4	SMART
low complexity region	700	705	N/A	INTRINSIC
IG	716	795	3.35e-5	SMART
IG	804	896	6.51e-3	SMART
IGc2	909	969	4.13e-5	SMART
IG_like	1001	1076	6.78e-2	SMART
low complexity region	1077	1088	N/A	INTRINSIC
IG	1094	1171	4.32e-8	SMART
IG_like	1185	1250	1.94e-2	SMART
IG	1268	1345	1.36e-5	SMART
IG_like	1354	1447	1.45e1	SMART
IG_like	1365	1435	4.51e-2	SMART
IG	1454	1534	4.56e-7	SMART

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.9%

Validation Efficiency

98% (112/114)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin superfamily. The encoded protein is a lectin-like adhesion molecule that binds glycoconjugate ligands on cell surfaces in a sialic acid-dependent manner. It is a type I transmembrane protein expressed only by a subpopulation of macrophages and is involved in mediating cell-cell interactions. Alternative splicing produces a transcript variant encoding an isoform that is soluble rather than membrane-bound; however, the full-length nature of this variant has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene display subtle changes in B- and T-cell populations and decreased IgM levels. Mice homozygous for a knock-out or knock-in allele exhibit impaired phagocytosis of sialylated C. jejuni. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110043O21Rik	C	T	4: 35,226,033		probably benign	Het
AA986860	T	A	1: 130,742,403	S121T	possibly damaging	Het
Abcb9	A	G	5: 124,078,804	V450A	probably benign	Het
Abcg1	A	T	17: 31,114,261	R659S	probably benign	Het
Acad9	A	T	3: 36,088,840	N508I	possibly damaging	Het
Acrbp	T	A	6: 125,060,918	C393S	probably damaging	Het
Adcy7	T	C	8: 88,317,937	V486A	probably benign	Het
Adgrf1	G	T	17: 43,310,493	L540F	probably damaging	Het
Ap5m1	T	C	14: 49,078,828	I285T	probably benign	Het
Arhgap27	G	T	11: 103,360,949		probably benign	Het
Armc5	A	T	7: 128,240,104	E198V	possibly damaging	Het
Atp8b5	A	T	4: 43,365,955	K742M	probably benign	Het
Atp9a	T	G	2: 168,661,964	T603P	possibly damaging	Het
Bsn	A	G	9: 108,110,130	S2808P	unknown	Het
Catsper4	T	C	4: 134,226,605	N81S	probably damaging	Het
Ccl17	C	G	8: 94,810,500	T10S	probably benign	Het
Cdc123	A	T	2: 5,844,892	V6D	probably damaging	Het
Cdca2	T	C	14: 67,714,966	K14E	possibly damaging	Het
Cdh3	C	A	8: 106,539,856	T302K	probably damaging	Het
Cdh9	A	G	15: 16,850,959	M605V	probably benign	Het
Cdk4	A	G	10: 127,064,911	E144G	possibly damaging	Het
Clasp1	C	T	1: 118,543,271	A879V	probably damaging	Het
Cldn8	G	A	16: 88,562,408	H210Y	probably benign	Het
Cntn5	T	C	9: 9,970,531	D518G	probably benign	Het
Cog1	C	T	11: 113,652,290	A208V	probably damaging	Het
Col4a2	T	A	8: 11,431,337	H836Q	possibly damaging	Het
Copb1	T	C	7: 114,248,976	D108G	probably damaging	Het
Csmd3	A	T	15: 48,161,083	Y600*	probably null	Het
Cyb5r1	T	A	1: 134,407,833	H164Q	probably benign	Het
Dkc1	A	G	X: 75,100,992	I215V	probably benign	Het
Enpep	A	G	3: 129,303,713		probably null	Het
Fam71b	T	A	11: 46,404,813	M4K	possibly damaging	Het
Fbln7	A	G	2: 128,894,886	Y311C	probably damaging	Het
Fign	A	C	2: 63,979,261	L555R	probably damaging	Het
Fkbp7	A	T	2: 76,671,688		probably benign	Het
Fmn2	T	C	1: 174,503,162	S373P	unknown	Het
Frmd4b	C	T	6: 97,295,666	D868N	possibly damaging	Het
Gfpt2	A	G	11: 49,823,737	N321S	probably benign	Het
Glmn	G	T	5: 107,561,075	T372K	probably damaging	Het
Gm26602	C	T	10: 79,910,974		probably benign	Het
Gm6797	A	G	X: 8,639,694		noncoding transcript	Het
Gpat3	T	A	5: 100,893,456	F383L	probably damaging	Het
Grrp1	A	G	4: 134,251,436	S244P	probably damaging	Het
H2-M11	C	T	17: 36,548,150	T194I	possibly damaging	Het
Hcn1	C	T	13: 117,657,015	H268Y	probably benign	Het
Hectd4	G	T	5: 121,325,251	C2345F	possibly damaging	Het
Htt	A	G	5: 34,820,080	D770G	probably benign	Het
Ints3	T	C	3: 90,408,510	T316A	possibly damaging	Het
Ipo9	A	G	1: 135,394,169	F608L	probably benign	Het
Irak1	A	C	X: 74,022,389		probably benign	Het
Jam2	G	A	16: 84,812,952	V151M	probably damaging	Het
Lag3	T	A	6: 124,904,545	Q488L	possibly damaging	Het
Large2	A	T	2: 92,367,558	L266Q	probably benign	Het
Lrp3	T	G	7: 35,203,940	D327A	probably damaging	Het
Mamstr	C	A	7: 45,644,692		probably benign	Het
Mettl14	G	A	3: 123,369,414		probably benign	Het
Miga1	A	G	3: 152,322,475	V139A	probably damaging	Het
Mthfd2l	A	C	5: 90,948,911	R130S	probably benign	Het
Myo1b	A	G	1: 51,757,973	I970T	possibly damaging	Het
Nat10	C	A	2: 103,732,170	W607L	probably damaging	Het
Nop56	A	G	2: 130,278,273	T183A	probably benign	Het
Olfr1258	A	G	2: 89,930,664	Y285C	possibly damaging	Het
Olfr239	A	G	17: 33,199,393	H115R	probably benign	Het
Olfr291	T	A	7: 84,856,904	Y178*	probably null	Het
Olfr464	T	A	11: 87,914,310	M199L	probably benign	Het
Olfr592	A	G	7: 103,187,102	Y167C	probably benign	Het
Olfr710	A	T	7: 106,944,945	S19T	probably benign	Het
Pcdhb12	T	C	18: 37,436,949	F383L	probably damaging	Het
Pde4dip	C	A	3: 97,695,005	D2252Y	probably damaging	Het
Peg10	GC	GCTCC	6: 4,756,452		probably benign	Het
Plscr2	T	G	9: 92,287,770	L91R	probably benign	Het
Plxnc1	T	A	10: 94,794,444	Y1531F	probably damaging	Het
Ptprq	A	T	10: 107,685,182	F710I	probably benign	Het
Rad51ap2	A	G	12: 11,456,551	E158G	probably damaging	Het
Rasip1	T	A	7: 45,627,823	H18Q	possibly damaging	Het
Rcsd1	T	A	1: 165,655,924	N166I	probably damaging	Het
Ripor1	T	A	8: 105,617,785	I517K	possibly damaging	Het
Ryr2	T	A	13: 11,824,369	H506L	probably benign	Het
Secisbp2l	C	T	2: 125,740,737	G933D	possibly damaging	Het
Sept14	T	C	5: 129,693,026	D202G	possibly damaging	Het
Slc22a29	T	A	19: 8,161,584	I505F	possibly damaging	Het
Sorcs1	T	A	19: 50,182,669	Y927F	probably benign	Het
Spats2	T	G	15: 99,180,722	M191R	possibly damaging	Het
Sycp1	C	T	3: 102,922,462		probably null	Het
T2	A	G	17: 8,391,016	E99G	possibly damaging	Het
Taf3	G	A	2: 10,048,564		probably benign	Het
Tnfsf10	A	T	3: 27,335,579	N263I	probably damaging	Het
Treml2	A	T	17: 48,308,175	R229S	probably benign	Het
Trmt13	T	C	3: 116,589,755	K125E	probably damaging	Het
Ttc9	G	T	12: 81,631,601	C66F	probably damaging	Het
Vmn2r63	C	T	7: 42,928,120	M331I	probably benign	Het
Zfp353-ps	T	C	8: 42,082,214		noncoding transcript	Het
Zfp932	A	T	5: 110,009,894	H486L	probably damaging	Het

Other mutations in Siglec1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00482:Siglec1	APN	2	131079325	missense	probably benign	0.03
IGL01092:Siglec1	APN	2	131079217	missense	probably damaging	1.00
IGL01115:Siglec1	APN	2	131074502	missense	probably benign	0.01
IGL01324:Siglec1	APN	2	131085541	missense	probably damaging	1.00
IGL01330:Siglec1	APN	2	131083536	missense	probably damaging	1.00
IGL01330:Siglec1	APN	2	131075005	nonsense	probably null
IGL01558:Siglec1	APN	2	131078499	missense	probably damaging	0.96
IGL01632:Siglec1	APN	2	131083820	missense	probably benign	0.03
IGL01768:Siglec1	APN	2	131074394	missense	probably benign
IGL02399:Siglec1	APN	2	131071178	missense	probably benign	0.16
IGL02558:Siglec1	APN	2	131074995	missense	possibly damaging	0.88
IGL02794:Siglec1	APN	2	131075969	missense	possibly damaging	0.86
IGL02839:Siglec1	APN	2	131084932	missense	possibly damaging	0.82
K3955:Siglec1	UTSW	2	131081439	missense	probably benign	0.00
P0038:Siglec1	UTSW	2	131081439	missense	probably benign	0.00
PIT4576001:Siglec1	UTSW	2	131078161	missense	probably damaging	1.00
PIT4677001:Siglec1	UTSW	2	131072757	missense	probably damaging	1.00
R0003:Siglec1	UTSW	2	131075060	missense	probably benign	0.00
R0048:Siglec1	UTSW	2	131073397	missense	possibly damaging	0.65
R0048:Siglec1	UTSW	2	131073397	missense	possibly damaging	0.65
R0243:Siglec1	UTSW	2	131085476	missense	probably damaging	1.00
R0276:Siglec1	UTSW	2	131083941	nonsense	probably null
R0379:Siglec1	UTSW	2	131074525	splice site	probably benign
R0464:Siglec1	UTSW	2	131079359	missense	probably damaging	1.00
R0507:Siglec1	UTSW	2	131074525	splice site	probably benign
R0560:Siglec1	UTSW	2	131070346	missense	probably benign	0.02
R0620:Siglec1	UTSW	2	131074268	missense	probably benign	0.30
R0621:Siglec1	UTSW	2	131074268	missense	probably benign	0.30
R0853:Siglec1	UTSW	2	131085022	missense	probably damaging	0.98
R1079:Siglec1	UTSW	2	131079377	nonsense	probably null
R1169:Siglec1	UTSW	2	131074827	missense	probably damaging	0.97
R1205:Siglec1	UTSW	2	131080464	missense	possibly damaging	0.94
R1293:Siglec1	UTSW	2	131073531	missense	probably benign	0.00
R1470:Siglec1	UTSW	2	131070387	missense	probably benign	0.19
R1470:Siglec1	UTSW	2	131070387	missense	probably benign	0.19
R1533:Siglec1	UTSW	2	131076158	missense	probably benign
R1717:Siglec1	UTSW	2	131073956	missense	possibly damaging	0.92
R1717:Siglec1	UTSW	2	131084012	missense	probably damaging	1.00
R1744:Siglec1	UTSW	2	131081299	missense	probably damaging	1.00
R1852:Siglec1	UTSW	2	131081500	missense	probably damaging	0.98
R1941:Siglec1	UTSW	2	131078131	missense	possibly damaging	0.94
R2011:Siglec1	UTSW	2	131083357	missense	probably damaging	1.00
R2012:Siglec1	UTSW	2	131083357	missense	probably damaging	1.00
R2128:Siglec1	UTSW	2	131080497	missense	probably damaging	1.00
R2278:Siglec1	UTSW	2	131071337	missense	probably benign	0.28
R2403:Siglec1	UTSW	2	131074475	missense	possibly damaging	0.65
R2449:Siglec1	UTSW	2	131078725	missense	probably benign	0.44
R2885:Siglec1	UTSW	2	131072747	missense	possibly damaging	0.88
R4213:Siglec1	UTSW	2	131074118	missense	probably damaging	1.00
R4274:Siglec1	UTSW	2	131085814	missense	probably benign	0.00
R4715:Siglec1	UTSW	2	131074436	missense	probably damaging	1.00
R4782:Siglec1	UTSW	2	131075923	missense	probably damaging	1.00
R4896:Siglec1	UTSW	2	131069869	missense	probably benign	0.21
R4993:Siglec1	UTSW	2	131073361	missense	possibly damaging	0.93
R5004:Siglec1	UTSW	2	131069869	missense	probably benign	0.21
R5004:Siglec1	UTSW	2	131073411	missense	possibly damaging	0.87
R5105:Siglec1	UTSW	2	131080400	missense	possibly damaging	0.69
R5137:Siglec1	UTSW	2	131081344	missense	probably damaging	1.00
R5153:Siglec1	UTSW	2	131085577	missense	probably damaging	0.99
R5311:Siglec1	UTSW	2	131079316	missense	probably damaging	1.00
R5600:Siglec1	UTSW	2	131085583	missense	probably benign	0.01
R5682:Siglec1	UTSW	2	131084010	missense	probably damaging	1.00
R5732:Siglec1	UTSW	2	131074268	missense	probably benign	0.30
R5870:Siglec1	UTSW	2	131072847	missense	probably damaging	0.99
R5898:Siglec1	UTSW	2	131073633	missense	probably damaging	1.00
R5909:Siglec1	UTSW	2	131077964	missense	probably damaging	1.00
R6488:Siglec1	UTSW	2	131081307	missense	probably damaging	0.99
R6920:Siglec1	UTSW	2	131078077	nonsense	probably null
R7064:Siglec1	UTSW	2	131083914	missense	probably benign	0.00
R7270:Siglec1	UTSW	2	131081551	missense	possibly damaging	0.67
R7355:Siglec1	UTSW	2	131080451	missense	probably benign	0.02
R7400:Siglec1	UTSW	2	131086095	missense	possibly damaging	0.73
R7470:Siglec1	UTSW	2	131075824	missense	probably benign	0.00
R7568:Siglec1	UTSW	2	131072682	missense	probably damaging	1.00
R7781:Siglec1	UTSW	2	131081338	missense	probably damaging	1.00
R7853:Siglec1	UTSW	2	131081292	missense	probably damaging	1.00
R7936:Siglec1	UTSW	2	131081292	missense	probably damaging	1.00
R7999:Siglec1	UTSW	2	131071163	missense	probably benign	0.28
X0024:Siglec1	UTSW	2	131080491	missense	probably damaging	1.00
Z1176:Siglec1	UTSW	2	131078745	missense	probably damaging	0.99
Z1176:Siglec1	UTSW	2	131080524	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- ACTGAGAGCCATGCCTTCTTAAG -3'
(R):5'- TCATGGTCGTGATTCAGTGC -3'

Sequencing Primer
(F):5'- CCATGCCTTCTTAAGCAGATTAGGG -3'
(R):5'- TGATTCAGTGCACCGTGGAC -3'

Posted On

2015-10-08