Incidental Mutation 'R4679:Vmn2r63'
ID349919
Institutional Source Beutler Lab
Gene Symbol Vmn2r63
Ensembl Gene ENSMUSG00000090751
Gene Namevomeronasal 2, receptor 63
SynonymsEG435975
MMRRC Submission 041932-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R4679 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location42903251-42933789 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 42928120 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 331 (M331I)
Ref Sequence ENSEMBL: ENSMUSP00000129089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163803]
Predicted Effect probably benign
Transcript: ENSMUST00000163803
AA Change: M331I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000129089
Gene: ENSMUSG00000090751
AA Change: M331I

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 471 3.5e-43 PFAM
Pfam:NCD3G 514 567 5.1e-23 PFAM
Pfam:7tm_3 600 835 3.5e-51 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 98% (112/114)
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik C T 4: 35,226,033 probably benign Het
AA986860 T A 1: 130,742,403 S121T possibly damaging Het
Abcb9 A G 5: 124,078,804 V450A probably benign Het
Abcg1 A T 17: 31,114,261 R659S probably benign Het
Acad9 A T 3: 36,088,840 N508I possibly damaging Het
Acrbp T A 6: 125,060,918 C393S probably damaging Het
Adcy7 T C 8: 88,317,937 V486A probably benign Het
Adgrf1 G T 17: 43,310,493 L540F probably damaging Het
Ap5m1 T C 14: 49,078,828 I285T probably benign Het
Arhgap27 G T 11: 103,360,949 probably benign Het
Armc5 A T 7: 128,240,104 E198V possibly damaging Het
Atp8b5 A T 4: 43,365,955 K742M probably benign Het
Atp9a T G 2: 168,661,964 T603P possibly damaging Het
Bsn A G 9: 108,110,130 S2808P unknown Het
Catsper4 T C 4: 134,226,605 N81S probably damaging Het
Ccl17 C G 8: 94,810,500 T10S probably benign Het
Cdc123 A T 2: 5,844,892 V6D probably damaging Het
Cdca2 T C 14: 67,714,966 K14E possibly damaging Het
Cdh3 C A 8: 106,539,856 T302K probably damaging Het
Cdh9 A G 15: 16,850,959 M605V probably benign Het
Cdk4 A G 10: 127,064,911 E144G possibly damaging Het
Clasp1 C T 1: 118,543,271 A879V probably damaging Het
Cldn8 G A 16: 88,562,408 H210Y probably benign Het
Cntn5 T C 9: 9,970,531 D518G probably benign Het
Cog1 C T 11: 113,652,290 A208V probably damaging Het
Col4a2 T A 8: 11,431,337 H836Q possibly damaging Het
Copb1 T C 7: 114,248,976 D108G probably damaging Het
Csmd3 A T 15: 48,161,083 Y600* probably null Het
Cyb5r1 T A 1: 134,407,833 H164Q probably benign Het
Dkc1 A G X: 75,100,992 I215V probably benign Het
Enpep A G 3: 129,303,713 probably null Het
Fam71b T A 11: 46,404,813 M4K possibly damaging Het
Fbln7 A G 2: 128,894,886 Y311C probably damaging Het
Fign A C 2: 63,979,261 L555R probably damaging Het
Fkbp7 A T 2: 76,671,688 probably benign Het
Fmn2 T C 1: 174,503,162 S373P unknown Het
Frmd4b C T 6: 97,295,666 D868N possibly damaging Het
Gfpt2 A G 11: 49,823,737 N321S probably benign Het
Glmn G T 5: 107,561,075 T372K probably damaging Het
Gm26602 C T 10: 79,910,974 probably benign Het
Gm6797 A G X: 8,639,694 noncoding transcript Het
Gpat3 T A 5: 100,893,456 F383L probably damaging Het
Grrp1 A G 4: 134,251,436 S244P probably damaging Het
H2-M11 C T 17: 36,548,150 T194I possibly damaging Het
Hcn1 C T 13: 117,657,015 H268Y probably benign Het
Hectd4 G T 5: 121,325,251 C2345F possibly damaging Het
Htt A G 5: 34,820,080 D770G probably benign Het
Ints3 T C 3: 90,408,510 T316A possibly damaging Het
Ipo9 A G 1: 135,394,169 F608L probably benign Het
Irak1 A C X: 74,022,389 probably benign Het
Jam2 G A 16: 84,812,952 V151M probably damaging Het
Lag3 T A 6: 124,904,545 Q488L possibly damaging Het
Large2 A T 2: 92,367,558 L266Q probably benign Het
Lrp3 T G 7: 35,203,940 D327A probably damaging Het
Mamstr C A 7: 45,644,692 probably benign Het
Mettl14 G A 3: 123,369,414 probably benign Het
Miga1 A G 3: 152,322,475 V139A probably damaging Het
Mthfd2l A C 5: 90,948,911 R130S probably benign Het
Myo1b A G 1: 51,757,973 I970T possibly damaging Het
Nat10 C A 2: 103,732,170 W607L probably damaging Het
Nop56 A G 2: 130,278,273 T183A probably benign Het
Olfr1258 A G 2: 89,930,664 Y285C possibly damaging Het
Olfr239 A G 17: 33,199,393 H115R probably benign Het
Olfr291 T A 7: 84,856,904 Y178* probably null Het
Olfr464 T A 11: 87,914,310 M199L probably benign Het
Olfr592 A G 7: 103,187,102 Y167C probably benign Het
Olfr710 A T 7: 106,944,945 S19T probably benign Het
Pcdhb12 T C 18: 37,436,949 F383L probably damaging Het
Pde4dip C A 3: 97,695,005 D2252Y probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Plscr2 T G 9: 92,287,770 L91R probably benign Het
Plxnc1 T A 10: 94,794,444 Y1531F probably damaging Het
Ptprq A T 10: 107,685,182 F710I probably benign Het
Rad51ap2 A G 12: 11,456,551 E158G probably damaging Het
Rasip1 T A 7: 45,627,823 H18Q possibly damaging Het
Rcsd1 T A 1: 165,655,924 N166I probably damaging Het
Ripor1 T A 8: 105,617,785 I517K possibly damaging Het
Ryr2 T A 13: 11,824,369 H506L probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sept14 T C 5: 129,693,026 D202G possibly damaging Het
Siglec1 A T 2: 131,073,411 L1420Q possibly damaging Het
Slc22a29 T A 19: 8,161,584 I505F possibly damaging Het
Sorcs1 T A 19: 50,182,669 Y927F probably benign Het
Spats2 T G 15: 99,180,722 M191R possibly damaging Het
Sycp1 C T 3: 102,922,462 probably null Het
T2 A G 17: 8,391,016 E99G possibly damaging Het
Taf3 G A 2: 10,048,564 probably benign Het
Tnfsf10 A T 3: 27,335,579 N263I probably damaging Het
Treml2 A T 17: 48,308,175 R229S probably benign Het
Trmt13 T C 3: 116,589,755 K125E probably damaging Het
Ttc9 G T 12: 81,631,601 C66F probably damaging Het
Zfp353-ps T C 8: 42,082,214 noncoding transcript Het
Zfp932 A T 5: 110,009,894 H486L probably damaging Het
Other mutations in Vmn2r63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Vmn2r63 APN 7 42904119 missense probably damaging 0.99
IGL01765:Vmn2r63 APN 7 42903364 missense probably benign
IGL02203:Vmn2r63 APN 7 42904008 missense probably benign 0.01
IGL02825:Vmn2r63 APN 7 42926850 critical splice donor site probably null
IGL03155:Vmn2r63 APN 7 42903454 missense probably damaging 1.00
IGL03260:Vmn2r63 APN 7 42929192 missense probably damaging 1.00
IGL03411:Vmn2r63 APN 7 42927944 missense probably benign 0.42
PIT4280001:Vmn2r63 UTSW 7 42903985 missense probably damaging 1.00
R0066:Vmn2r63 UTSW 7 42927090 splice site probably benign
R0328:Vmn2r63 UTSW 7 42903275 missense probably benign 0.09
R0344:Vmn2r63 UTSW 7 42903618 missense probably damaging 0.98
R0554:Vmn2r63 UTSW 7 42933705 nonsense probably null
R0555:Vmn2r63 UTSW 7 42928528 nonsense probably null
R0685:Vmn2r63 UTSW 7 42928010 missense probably benign 0.13
R0751:Vmn2r63 UTSW 7 42928035 missense probably damaging 1.00
R1349:Vmn2r63 UTSW 7 42929218 missense possibly damaging 0.95
R1372:Vmn2r63 UTSW 7 42929218 missense possibly damaging 0.95
R1416:Vmn2r63 UTSW 7 42927915 missense probably benign 0.00
R1502:Vmn2r63 UTSW 7 42928591 missense possibly damaging 0.62
R1563:Vmn2r63 UTSW 7 42904126 missense probably benign 0.00
R1652:Vmn2r63 UTSW 7 42928211 missense probably benign 0.32
R1693:Vmn2r63 UTSW 7 42928319 missense probably benign
R1698:Vmn2r63 UTSW 7 42933614 missense probably benign
R1753:Vmn2r63 UTSW 7 42928245 nonsense probably null
R2136:Vmn2r63 UTSW 7 42926873 missense probably damaging 0.99
R2175:Vmn2r63 UTSW 7 42933580 critical splice donor site probably null
R2261:Vmn2r63 UTSW 7 42928607 missense probably benign 0.02
R2262:Vmn2r63 UTSW 7 42928607 missense probably benign 0.02
R2263:Vmn2r63 UTSW 7 42928607 missense probably benign 0.02
R3413:Vmn2r63 UTSW 7 42926982 missense probably benign 0.04
R3426:Vmn2r63 UTSW 7 42926982 missense probably benign 0.04
R3427:Vmn2r63 UTSW 7 42926982 missense probably benign 0.04
R3802:Vmn2r63 UTSW 7 42903405 missense probably damaging 0.99
R4319:Vmn2r63 UTSW 7 42926982 missense probably benign 0.04
R4321:Vmn2r63 UTSW 7 42926982 missense probably benign 0.04
R4323:Vmn2r63 UTSW 7 42926982 missense probably benign 0.04
R4346:Vmn2r63 UTSW 7 42928113 missense possibly damaging 0.67
R4568:Vmn2r63 UTSW 7 42933826 splice site probably null
R4649:Vmn2r63 UTSW 7 42903690 missense possibly damaging 0.79
R4653:Vmn2r63 UTSW 7 42903690 missense possibly damaging 0.79
R4734:Vmn2r63 UTSW 7 42928120 missense probably benign 0.00
R4741:Vmn2r63 UTSW 7 42928120 missense probably benign 0.00
R4748:Vmn2r63 UTSW 7 42928120 missense probably benign 0.00
R4806:Vmn2r63 UTSW 7 42926890 missense probably benign 0.34
R4933:Vmn2r63 UTSW 7 42903978 missense probably damaging 1.00
R5198:Vmn2r63 UTSW 7 42903745 missense probably benign 0.01
R5399:Vmn2r63 UTSW 7 42928277 missense probably benign
R5400:Vmn2r63 UTSW 7 42928211 missense probably benign 0.32
R6158:Vmn2r63 UTSW 7 42933680 missense probably damaging 1.00
R6185:Vmn2r63 UTSW 7 42929011 missense probably damaging 0.98
R6267:Vmn2r63 UTSW 7 42928635 splice site probably null
R6362:Vmn2r63 UTSW 7 42903297 missense probably benign
R6706:Vmn2r63 UTSW 7 42928577 missense probably damaging 1.00
R6764:Vmn2r63 UTSW 7 42903271 missense probably damaging 0.97
R7104:Vmn2r63 UTSW 7 42928535 missense possibly damaging 0.67
R7503:Vmn2r63 UTSW 7 42933590 missense probably benign 0.02
R7506:Vmn2r63 UTSW 7 42926967 missense probably damaging 1.00
R7525:Vmn2r63 UTSW 7 42926982 missense possibly damaging 0.52
R7658:Vmn2r63 UTSW 7 42925269 missense probably damaging 1.00
R7663:Vmn2r63 UTSW 7 42927042 missense probably benign 0.00
R7702:Vmn2r63 UTSW 7 42928129 missense possibly damaging 0.46
R7918:Vmn2r63 UTSW 7 42903531 missense probably damaging 1.00
Z1088:Vmn2r63 UTSW 7 42928559 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- ATGTGTCTGGGAAGTAAGTCC -3'
(R):5'- CCTGGCACCTGGAATTCATATTC -3'

Sequencing Primer
(F):5'- CCAAAGATGCATTGGGTTGGC -3'
(R):5'- GGCACCTGGAATTCATATTCTGATGC -3'
Posted On2015-10-08