Incidental Mutation 'R0267:Polr1a'
ID34993
Institutional Source Beutler Lab
Gene Symbol Polr1a
Ensembl Gene ENSMUSG00000049553
Gene Namepolymerase (RNA) I polypeptide A
SynonymsRPA194, 3010014K16Rik, 194kDa, mRPA1, Rpo1-4
MMRRC Submission 038493-MU
Accession Numbers

Genbank: NM_009088; MGI: 1096397

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0267 (G1)
Quality Score127
Status Validated
Chromosome6
Chromosomal Location71909053-71984935 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 71974139 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 1407 (I1407M)
Ref Sequence ENSEMBL: ENSMUSP00000060858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055296]
Predicted Effect probably damaging
Transcript: ENSMUST00000055296
AA Change: I1407M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000060858
Gene: ENSMUSG00000049553
AA Change: I1407M

DomainStartEndE-ValueType
RPOLA_N 302 649 8.97e-137 SMART
Pfam:RNA_pol_Rpb1_4 846 958 1.3e-26 PFAM
Pfam:RNA_pol_Rpb1_5 965 1669 7e-103 PFAM
low complexity region 1698 1708 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000205517
AA Change: I432M
Meta Mutation Damage Score 0.1037 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.7%
  • 10x: 96.2%
  • 20x: 94.0%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the largest subunit of the RNA polymerase I complex. The encoded protein represents the catalytic subunit of the complex, which transcribes DNA into ribosomal RNA precursors. Defects in this gene are a cause of the Cincinnati type of acrofacial dysostosis. [provided by RefSeq, May 2016]
Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,046,105 F1721S probably damaging Het
Adgrb1 G A 15: 74,529,389 R78H probably damaging Het
Adgrd1 G A 5: 129,139,594 A342T probably benign Het
Adrb1 A T 19: 56,723,491 K374* probably null Het
Aldh18a1 C A 19: 40,573,789 V264F probably benign Het
Aldh1l2 C T 10: 83,522,687 probably benign Het
Alox15 T A 11: 70,346,153 H393L probably damaging Het
Aox2 A G 1: 58,339,446 probably benign Het
Appbp2 T C 11: 85,201,462 Y297C probably damaging Het
Atxn2l T G 7: 126,493,207 Q950P probably damaging Het
Bicd1 A T 6: 149,517,042 D737V probably damaging Het
C9 T C 15: 6,467,458 I212T probably benign Het
Ccdc63 A T 5: 122,117,044 probably benign Het
Chst1 C A 2: 92,613,606 P141Q probably damaging Het
Cped1 T A 6: 22,119,476 F311L probably damaging Het
D6Wsu163e T A 6: 126,946,491 H113Q probably benign Het
Dcn A T 10: 97,506,483 probably benign Het
Dmbx1 C T 4: 115,918,112 A324T probably benign Het
Dock10 G T 1: 80,512,454 Q1618K probably damaging Het
Dpyd A G 3: 118,917,272 E443G probably benign Het
Espl1 T C 15: 102,313,017 V953A possibly damaging Het
Exosc10 T C 4: 148,562,756 L174P probably damaging Het
Foxg1 A G 12: 49,385,582 Y366C probably damaging Het
Fxyd3 T C 7: 31,070,734 probably benign Het
Gbp2 T C 3: 142,630,106 V189A probably benign Het
Gins4 T C 8: 23,229,410 probably benign Het
Gm12789 A G 4: 101,988,122 T3A probably benign Het
Gnb1l T C 16: 18,548,089 probably benign Het
Gtpbp3 T C 8: 71,491,497 L295S probably damaging Het
Hrh4 C A 18: 13,022,398 Y331* probably null Het
Hsd11b1 A T 1: 193,241,397 Y52N probably damaging Het
Jam3 A G 9: 27,106,405 I29T probably benign Het
Kctd16 T A 18: 40,530,877 I353N probably benign Het
Lama4 G T 10: 39,028,639 G246C probably damaging Het
Lhx3 T A 2: 26,203,028 M137L probably benign Het
Morc2a T C 11: 3,678,567 I340T probably benign Het
Myo7a A C 7: 98,054,624 I1969S probably benign Het
Olfr1471 T A 19: 13,445,428 C139S probably damaging Het
Olfr304 T C 7: 86,386,267 E131G possibly damaging Het
Olfr429 A G 1: 174,089,166 N42S probably damaging Het
Pclo T C 5: 14,681,180 L3232P unknown Het
Ppip5k2 A G 1: 97,728,997 V817A probably damaging Het
Rbfox3 T C 11: 118,495,240 T280A probably benign Het
Rfx3 T C 19: 27,793,788 D521G probably benign Het
Scn5a C T 9: 119,543,135 V223I probably damaging Het
Sgsm3 T G 15: 81,006,602 M119R probably damaging Het
Slc6a7 T A 18: 60,996,711 M608L probably benign Het
Slit2 A G 5: 48,182,331 probably benign Het
Steap2 T A 5: 5,673,561 I440F probably benign Het
Syn2 T G 6: 115,254,150 probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tfb2m G A 1: 179,533,638 H262Y probably benign Het
Trmt1l A G 1: 151,457,675 probably benign Het
Trpm6 C A 19: 18,823,378 P819T probably benign Het
Ttn G A 2: 76,743,689 A25620V probably damaging Het
Ubn2 T C 6: 38,482,618 probably null Het
Vars T C 17: 35,011,596 probably benign Het
Vip A T 10: 5,644,004 D119V possibly damaging Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Vps33b T C 7: 80,286,054 I405T possibly damaging Het
Zbtb21 T A 16: 97,952,100 S356C probably damaging Het
Zdhhc6 A T 19: 55,308,930 S237T probably benign Het
Zfp142 G A 1: 74,576,064 A427V probably benign Het
Zfp692 T A 11: 58,314,314 V463E possibly damaging Het
Zmynd8 A T 2: 165,828,402 I384N probably damaging Het
Other mutations in Polr1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Polr1a APN 6 71948486 missense probably benign 0.32
IGL01834:Polr1a APN 6 71948462 missense probably benign
IGL01902:Polr1a APN 6 71963748 missense probably damaging 1.00
IGL02101:Polr1a APN 6 71950802 missense probably benign 0.00
IGL02325:Polr1a APN 6 71920657 missense probably benign 0.38
IGL02398:Polr1a APN 6 71936556 splice site probably benign
IGL02528:Polr1a APN 6 71964717 missense probably benign
IGL02555:Polr1a APN 6 71920457 missense probably damaging 0.98
IGL02613:Polr1a APN 6 71967320 missense probably damaging 1.00
IGL02693:Polr1a APN 6 71963846 splice site probably benign
IGL02892:Polr1a APN 6 71931696 missense possibly damaging 0.70
IGL03059:Polr1a APN 6 71936512 missense probably benign
IGL03174:Polr1a APN 6 71977347 missense possibly damaging 0.82
D4043:Polr1a UTSW 6 71941417 missense possibly damaging 0.92
R0092:Polr1a UTSW 6 71967455 splice site probably benign
R0217:Polr1a UTSW 6 71963703 missense probably benign 0.19
R0329:Polr1a UTSW 6 71966416 missense possibly damaging 0.96
R0330:Polr1a UTSW 6 71966416 missense possibly damaging 0.96
R0352:Polr1a UTSW 6 71920763 splice site probably benign
R0411:Polr1a UTSW 6 71978421 missense possibly damaging 0.95
R0446:Polr1a UTSW 6 71950664 critical splice donor site probably null
R0846:Polr1a UTSW 6 71924643 missense probably damaging 1.00
R1035:Polr1a UTSW 6 71967916 missense probably benign
R1294:Polr1a UTSW 6 71912902 missense probably damaging 0.99
R1460:Polr1a UTSW 6 71941384 missense probably damaging 0.99
R1657:Polr1a UTSW 6 71941535 missense probably damaging 1.00
R1846:Polr1a UTSW 6 71976188 missense probably damaging 0.98
R1862:Polr1a UTSW 6 71909203 missense probably damaging 0.96
R1865:Polr1a UTSW 6 71966524 missense probably damaging 1.00
R1903:Polr1a UTSW 6 71967914 missense probably benign 0.02
R1937:Polr1a UTSW 6 71936552 critical splice donor site probably null
R2063:Polr1a UTSW 6 71936285 splice site probably null
R2071:Polr1a UTSW 6 71976074 missense possibly damaging 0.64
R2084:Polr1a UTSW 6 71950809 missense possibly damaging 0.69
R2377:Polr1a UTSW 6 71972826 critical splice donor site probably null
R2410:Polr1a UTSW 6 71974882 missense probably benign
R3001:Polr1a UTSW 6 71965644 missense probably benign 0.02
R3001:Polr1a UTSW 6 71913016 missense probably benign 0.01
R3002:Polr1a UTSW 6 71913016 missense probably benign 0.01
R3002:Polr1a UTSW 6 71965644 missense probably benign 0.02
R3924:Polr1a UTSW 6 71929450 missense probably benign 0.00
R4105:Polr1a UTSW 6 71976191 missense probably damaging 0.98
R4125:Polr1a UTSW 6 71965706 missense probably benign 0.00
R4271:Polr1a UTSW 6 71953022 missense probably benign 0.02
R4440:Polr1a UTSW 6 71950848 missense probably damaging 0.98
R4667:Polr1a UTSW 6 71917821 missense probably benign 0.30
R4769:Polr1a UTSW 6 71950868 missense probably benign 0.01
R4801:Polr1a UTSW 6 71976070 missense probably benign 0.00
R4802:Polr1a UTSW 6 71976070 missense probably benign 0.00
R4828:Polr1a UTSW 6 71966401 missense possibly damaging 0.93
R4911:Polr1a UTSW 6 71909229 missense possibly damaging 0.67
R5071:Polr1a UTSW 6 71931709 missense possibly damaging 0.71
R5165:Polr1a UTSW 6 71967925 missense probably damaging 1.00
R5223:Polr1a UTSW 6 71967907 missense possibly damaging 0.73
R5239:Polr1a UTSW 6 71913037 missense probably damaging 1.00
R5546:Polr1a UTSW 6 71929366 missense possibly damaging 0.64
R5599:Polr1a UTSW 6 71967362 missense possibly damaging 0.95
R5696:Polr1a UTSW 6 71929426 missense probably benign 0.05
R5850:Polr1a UTSW 6 71926683 missense probably benign 0.00
R6274:Polr1a UTSW 6 71954890 splice site probably null
R6526:Polr1a UTSW 6 71929443 missense possibly damaging 0.89
R6578:Polr1a UTSW 6 71976041 missense possibly damaging 0.93
R6660:Polr1a UTSW 6 71967374 missense probably damaging 0.98
R6892:Polr1a UTSW 6 71964712 missense possibly damaging 0.72
R7274:Polr1a UTSW 6 71920516 nonsense probably null
R7291:Polr1a UTSW 6 71941456 missense probably benign 0.02
R7311:Polr1a UTSW 6 71950879 missense possibly damaging 0.53
R7431:Polr1a UTSW 6 71926659 missense probably benign 0.14
R7479:Polr1a UTSW 6 71936297 missense probably damaging 1.00
R7607:Polr1a UTSW 6 71913021 missense probably benign
R7739:Polr1a UTSW 6 71954835 missense possibly damaging 0.94
R7746:Polr1a UTSW 6 71941512 missense probably damaging 1.00
R7764:Polr1a UTSW 6 71953070 missense probably damaging 1.00
R7835:Polr1a UTSW 6 71915142 missense probably benign 0.02
R8029:Polr1a UTSW 6 71912956 nonsense probably null
R8057:Polr1a UTSW 6 71931660 missense possibly damaging 0.95
R8144:Polr1a UTSW 6 71950616 missense probably benign
R8170:Polr1a UTSW 6 71920749 missense probably benign
R8320:Polr1a UTSW 6 71941384 missense probably damaging 0.99
R8328:Polr1a UTSW 6 71920734 missense probably benign
R8331:Polr1a UTSW 6 71976179 missense probably damaging 1.00
R8362:Polr1a UTSW 6 71964667 missense probably benign 0.00
R8511:Polr1a UTSW 6 71920520 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTCCTGAGAGTGATGCAGACACC -3'
(R):5'- CATCAAGAGGTACGCTGGACAGAC -3'

Sequencing Primer
(F):5'- AGCAAACCCATTGCTCTGTATG -3'
(R):5'- ATTTCTGGTGGGTTCCCAGT -3'
Posted On2013-05-09