Mutagenetix > Incidental Mutation

Incidental Mutation 'R0267:Polr1a'

34993

Institutional Source

Beutler Lab

Gene Symbol

Polr1a

Ensembl Gene

ENSMUSG00000049553

Gene Name

polymerase (RNA) I polypeptide A

Synonyms

RPA194, 3010014K16Rik, 194kDa, mRPA1, Rpo1-4

MMRRC Submission

038493-MU

Accession Numbers

Genbank: NM_009088; MGI: 1096397

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0267 (G1)

Quality Score

127

Status

Validated

Chromosome

Chromosomal Location

71909053-71984935 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 71974139 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 1407 (I1407M)

Ref Sequence

ENSEMBL: ENSMUSP00000060858 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055296]

AlphaFold

O35134

Predicted Effect

probably damaging
Transcript: ENSMUST00000055296
AA Change: I1407M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000060858
Gene: ENSMUSG00000049553
AA Change: I1407M

Domain	Start	End	E-Value	Type
RPOLA_N	302	649	8.97e-137	SMART
Pfam:RNA_pol_Rpb1_4	846	958	1.3e-26	PFAM
Pfam:RNA_pol_Rpb1_5	965	1669	7e-103	PFAM
low complexity region	1698	1708	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000205517
AA Change: I432M

Meta Mutation Damage Score

0.1037

Coding Region Coverage

1x: 98.6%
3x: 97.7%
10x: 96.2%
20x: 94.0%

Validation Efficiency

97% (64/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the largest subunit of the RNA polymerase I complex. The encoded protein represents the catalytic subunit of the complex, which transcribes DNA into ribosomal RNA precursors. Defects in this gene are a cause of the Cincinnati type of acrofacial dysostosis. [provided by RefSeq, May 2016]

Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	A	G	4: 53,046,105	F1721S	probably damaging	Het
Adgrb1	G	A	15: 74,529,389	R78H	probably damaging	Het
Adgrd1	G	A	5: 129,139,594	A342T	probably benign	Het
Adrb1	A	T	19: 56,723,491	K374*	probably null	Het
Aldh18a1	C	A	19: 40,573,789	V264F	probably benign	Het
Aldh1l2	C	T	10: 83,522,687		probably benign	Het
Alox15	T	A	11: 70,346,153	H393L	probably damaging	Het
Aox2	A	G	1: 58,339,446		probably benign	Het
Appbp2	T	C	11: 85,201,462	Y297C	probably damaging	Het
Atxn2l	T	G	7: 126,493,207	Q950P	probably damaging	Het
Bicd1	A	T	6: 149,517,042	D737V	probably damaging	Het
C9	T	C	15: 6,467,458	I212T	probably benign	Het
Ccdc63	A	T	5: 122,117,044		probably benign	Het
Chst1	C	A	2: 92,613,606	P141Q	probably damaging	Het
Cped1	T	A	6: 22,119,476	F311L	probably damaging	Het
D6Wsu163e	T	A	6: 126,946,491	H113Q	probably benign	Het
Dcn	A	T	10: 97,506,483		probably benign	Het
Dmbx1	C	T	4: 115,918,112	A324T	probably benign	Het
Dock10	G	T	1: 80,512,454	Q1618K	probably damaging	Het
Dpyd	A	G	3: 118,917,272	E443G	probably benign	Het
Espl1	T	C	15: 102,313,017	V953A	possibly damaging	Het
Exosc10	T	C	4: 148,562,756	L174P	probably damaging	Het
Foxg1	A	G	12: 49,385,582	Y366C	probably damaging	Het
Fxyd3	T	C	7: 31,070,734		probably benign	Het
Gbp2	T	C	3: 142,630,106	V189A	probably benign	Het
Gins4	T	C	8: 23,229,410		probably benign	Het
Gm12789	A	G	4: 101,988,122	T3A	probably benign	Het
Gnb1l	T	C	16: 18,548,089		probably benign	Het
Gtpbp3	T	C	8: 71,491,497	L295S	probably damaging	Het
Hrh4	C	A	18: 13,022,398	Y331*	probably null	Het
Hsd11b1	A	T	1: 193,241,397	Y52N	probably damaging	Het
Jam3	A	G	9: 27,106,405	I29T	probably benign	Het
Kctd16	T	A	18: 40,530,877	I353N	probably benign	Het
Lama4	G	T	10: 39,028,639	G246C	probably damaging	Het
Lhx3	T	A	2: 26,203,028	M137L	probably benign	Het
Morc2a	T	C	11: 3,678,567	I340T	probably benign	Het
Myo7a	A	C	7: 98,054,624	I1969S	probably benign	Het
Olfr1471	T	A	19: 13,445,428	C139S	probably damaging	Het
Olfr304	T	C	7: 86,386,267	E131G	possibly damaging	Het
Olfr429	A	G	1: 174,089,166	N42S	probably damaging	Het
Pclo	T	C	5: 14,681,180	L3232P	unknown	Het
Ppip5k2	A	G	1: 97,728,997	V817A	probably damaging	Het
Rbfox3	T	C	11: 118,495,240	T280A	probably benign	Het
Rfx3	T	C	19: 27,793,788	D521G	probably benign	Het
Scn5a	C	T	9: 119,543,135	V223I	probably damaging	Het
Sgsm3	T	G	15: 81,006,602	M119R	probably damaging	Het
Slc6a7	T	A	18: 60,996,711	M608L	probably benign	Het
Slit2	A	G	5: 48,182,331		probably benign	Het
Steap2	T	A	5: 5,673,561	I440F	probably benign	Het
Syn2	T	G	6: 115,254,150		probably benign	Het
Taar2	G	A	10: 23,941,495	R311H	probably benign	Het
Tfb2m	G	A	1: 179,533,638	H262Y	probably benign	Het
Trmt1l	A	G	1: 151,457,675		probably benign	Het
Trpm6	C	A	19: 18,823,378	P819T	probably benign	Het
Ttn	G	A	2: 76,743,689	A25620V	probably damaging	Het
Ubn2	T	C	6: 38,482,618		probably null	Het
Vars	T	C	17: 35,011,596		probably benign	Het
Vip	A	T	10: 5,644,004	D119V	possibly damaging	Het
Vmn2r92	C	T	17: 18,167,957	A408V	probably damaging	Het
Vps33b	T	C	7: 80,286,054	I405T	possibly damaging	Het
Zbtb21	T	A	16: 97,952,100	S356C	probably damaging	Het
Zdhhc6	A	T	19: 55,308,930	S237T	probably benign	Het
Zfp142	G	A	1: 74,576,064	A427V	probably benign	Het
Zfp692	T	A	11: 58,314,314	V463E	possibly damaging	Het
Zmynd8	A	T	2: 165,828,402	I384N	probably damaging	Het

Other mutations in Polr1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01363:Polr1a	APN	6	71948486	missense	probably benign	0.32
IGL01834:Polr1a	APN	6	71948462	missense	probably benign
IGL01902:Polr1a	APN	6	71963748	missense	probably damaging	1.00
IGL02101:Polr1a	APN	6	71950802	missense	probably benign	0.00
IGL02325:Polr1a	APN	6	71920657	missense	probably benign	0.38
IGL02398:Polr1a	APN	6	71936556	splice site	probably benign
IGL02528:Polr1a	APN	6	71964717	missense	probably benign
IGL02555:Polr1a	APN	6	71920457	missense	probably damaging	0.98
IGL02613:Polr1a	APN	6	71967320	missense	probably damaging	1.00
IGL02693:Polr1a	APN	6	71963846	splice site	probably benign
IGL02892:Polr1a	APN	6	71931696	missense	possibly damaging	0.70
IGL03059:Polr1a	APN	6	71936512	missense	probably benign
IGL03174:Polr1a	APN	6	71977347	missense	possibly damaging	0.82
D4043:Polr1a	UTSW	6	71941417	missense	possibly damaging	0.92
R0092:Polr1a	UTSW	6	71967455	splice site	probably benign
R0217:Polr1a	UTSW	6	71963703	missense	probably benign	0.19
R0329:Polr1a	UTSW	6	71966416	missense	possibly damaging	0.96
R0330:Polr1a	UTSW	6	71966416	missense	possibly damaging	0.96
R0352:Polr1a	UTSW	6	71920763	splice site	probably benign
R0411:Polr1a	UTSW	6	71978421	missense	possibly damaging	0.95
R0446:Polr1a	UTSW	6	71950664	critical splice donor site	probably null
R0846:Polr1a	UTSW	6	71924643	missense	probably damaging	1.00
R1035:Polr1a	UTSW	6	71967916	missense	probably benign
R1294:Polr1a	UTSW	6	71912902	missense	probably damaging	0.99
R1460:Polr1a	UTSW	6	71941384	missense	probably damaging	0.99
R1657:Polr1a	UTSW	6	71941535	missense	probably damaging	1.00
R1846:Polr1a	UTSW	6	71976188	missense	probably damaging	0.98
R1862:Polr1a	UTSW	6	71909203	missense	probably damaging	0.96
R1865:Polr1a	UTSW	6	71966524	missense	probably damaging	1.00
R1903:Polr1a	UTSW	6	71967914	missense	probably benign	0.02
R1937:Polr1a	UTSW	6	71936552	critical splice donor site	probably null
R2063:Polr1a	UTSW	6	71936285	splice site	probably null
R2071:Polr1a	UTSW	6	71976074	missense	possibly damaging	0.64
R2084:Polr1a	UTSW	6	71950809	missense	possibly damaging	0.69
R2377:Polr1a	UTSW	6	71972826	critical splice donor site	probably null
R2410:Polr1a	UTSW	6	71974882	missense	probably benign
R3001:Polr1a	UTSW	6	71913016	missense	probably benign	0.01
R3001:Polr1a	UTSW	6	71965644	missense	probably benign	0.02
R3002:Polr1a	UTSW	6	71913016	missense	probably benign	0.01
R3002:Polr1a	UTSW	6	71965644	missense	probably benign	0.02
R3924:Polr1a	UTSW	6	71929450	missense	probably benign	0.00
R4105:Polr1a	UTSW	6	71976191	missense	probably damaging	0.98
R4125:Polr1a	UTSW	6	71965706	missense	probably benign	0.00
R4271:Polr1a	UTSW	6	71953022	missense	probably benign	0.02
R4440:Polr1a	UTSW	6	71950848	missense	probably damaging	0.98
R4667:Polr1a	UTSW	6	71917821	missense	probably benign	0.30
R4769:Polr1a	UTSW	6	71950868	missense	probably benign	0.01
R4801:Polr1a	UTSW	6	71976070	missense	probably benign	0.00
R4802:Polr1a	UTSW	6	71976070	missense	probably benign	0.00
R4828:Polr1a	UTSW	6	71966401	missense	possibly damaging	0.93
R4911:Polr1a	UTSW	6	71909229	missense	possibly damaging	0.67
R5071:Polr1a	UTSW	6	71931709	missense	possibly damaging	0.71
R5165:Polr1a	UTSW	6	71967925	missense	probably damaging	1.00
R5223:Polr1a	UTSW	6	71967907	missense	possibly damaging	0.73
R5239:Polr1a	UTSW	6	71913037	missense	probably damaging	1.00
R5546:Polr1a	UTSW	6	71929366	missense	possibly damaging	0.64
R5599:Polr1a	UTSW	6	71967362	missense	possibly damaging	0.95
R5696:Polr1a	UTSW	6	71929426	missense	probably benign	0.05
R5850:Polr1a	UTSW	6	71926683	missense	probably benign	0.00
R6274:Polr1a	UTSW	6	71954890	splice site	probably null
R6526:Polr1a	UTSW	6	71929443	missense	possibly damaging	0.89
R6578:Polr1a	UTSW	6	71976041	missense	possibly damaging	0.93
R6660:Polr1a	UTSW	6	71967374	missense	probably damaging	0.98
R6892:Polr1a	UTSW	6	71964712	missense	possibly damaging	0.72
R7274:Polr1a	UTSW	6	71920516	nonsense	probably null
R7291:Polr1a	UTSW	6	71941456	missense	probably benign	0.02
R7311:Polr1a	UTSW	6	71950879	missense	possibly damaging	0.53
R7431:Polr1a	UTSW	6	71926659	missense	probably benign	0.14
R7479:Polr1a	UTSW	6	71936297	missense	probably damaging	1.00
R7607:Polr1a	UTSW	6	71913021	missense	probably benign
R7739:Polr1a	UTSW	6	71954835	missense	possibly damaging	0.94
R7746:Polr1a	UTSW	6	71941512	missense	probably damaging	1.00
R7764:Polr1a	UTSW	6	71953070	missense	probably damaging	1.00
R7835:Polr1a	UTSW	6	71915142	missense	probably benign	0.02
R8029:Polr1a	UTSW	6	71912956	nonsense	probably null
R8057:Polr1a	UTSW	6	71931660	missense	possibly damaging	0.95
R8144:Polr1a	UTSW	6	71950616	missense	probably benign
R8170:Polr1a	UTSW	6	71920749	missense	probably benign
R8320:Polr1a	UTSW	6	71941384	missense	probably damaging	0.99
R8328:Polr1a	UTSW	6	71920734	missense	probably benign
R8331:Polr1a	UTSW	6	71976179	missense	probably damaging	1.00
R8362:Polr1a	UTSW	6	71964667	missense	probably benign	0.00
R8511:Polr1a	UTSW	6	71920520	missense	probably benign	0.01
R8709:Polr1a	UTSW	6	71974848	missense	probably benign
R8745:Polr1a	UTSW	6	71954771	missense	probably damaging	1.00
R8784:Polr1a	UTSW	6	71950628	missense	probably benign
R9055:Polr1a	UTSW	6	71915069	missense	possibly damaging	0.46
R9088:Polr1a	UTSW	6	71931783	missense	probably benign	0.26
R9211:Polr1a	UTSW	6	71966537	missense	probably damaging	1.00
R9228:Polr1a	UTSW	6	71954771	missense	probably damaging	1.00
R9240:Polr1a	UTSW	6	71963677	nonsense	probably null
R9267:Polr1a	UTSW	6	71965558	missense	probably benign
R9302:Polr1a	UTSW	6	71924699	critical splice donor site	probably null
R9744:Polr1a	UTSW	6	71929388	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- TGTCCTGAGAGTGATGCAGACACC -3'
(R):5'- CATCAAGAGGTACGCTGGACAGAC -3'

Sequencing Primer
(F):5'- AGCAAACCCATTGCTCTGTATG -3'
(R):5'- ATTTCTGGTGGGTTCCCAGT -3'

Posted On

2013-05-09