Incidental Mutation 'R0267:Polr1a'
ID 34993
Institutional Source Beutler Lab
Gene Symbol Polr1a
Ensembl Gene ENSMUSG00000049553
Gene Name polymerase (RNA) I polypeptide A
Synonyms 2900087K15Rik, 3010014K16Rik, 194kDa, mRPA1, Rpo1-4, RPA194
MMRRC Submission 038493-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0267 (G1)
Quality Score 127
Status Validated
Chromosome 6
Chromosomal Location 71886037-71956419 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 71951123 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 1407 (I1407M)
Ref Sequence ENSEMBL: ENSMUSP00000060858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055296]
AlphaFold O35134
Predicted Effect probably damaging
Transcript: ENSMUST00000055296
AA Change: I1407M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000060858
Gene: ENSMUSG00000049553
AA Change: I1407M

DomainStartEndE-ValueType
RPOLA_N 302 649 8.97e-137 SMART
Pfam:RNA_pol_Rpb1_4 846 958 1.3e-26 PFAM
Pfam:RNA_pol_Rpb1_5 965 1669 7e-103 PFAM
low complexity region 1698 1708 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000205517
AA Change: I432M
Meta Mutation Damage Score 0.1037 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.7%
  • 10x: 96.2%
  • 20x: 94.0%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the largest subunit of the RNA polymerase I complex. The encoded protein represents the catalytic subunit of the complex, which transcribes DNA into ribosomal RNA precursors. Defects in this gene are a cause of the Cincinnati type of acrofacial dysostosis. [provided by RefSeq, May 2016]
Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,046,105 (GRCm39) F1721S probably damaging Het
Adgrb1 G A 15: 74,401,238 (GRCm39) R78H probably damaging Het
Adgrd1 G A 5: 129,216,658 (GRCm39) A342T probably benign Het
Adrb1 A T 19: 56,711,923 (GRCm39) K374* probably null Het
Aldh18a1 C A 19: 40,562,233 (GRCm39) V264F probably benign Het
Aldh1l2 C T 10: 83,358,551 (GRCm39) probably benign Het
Alox15 T A 11: 70,236,979 (GRCm39) H393L probably damaging Het
Aox1 A G 1: 58,378,605 (GRCm39) probably benign Het
Appbp2 T C 11: 85,092,288 (GRCm39) Y297C probably damaging Het
Atxn2l T G 7: 126,092,379 (GRCm39) Q950P probably damaging Het
Bicd1 A T 6: 149,418,540 (GRCm39) D737V probably damaging Het
C9 T C 15: 6,496,939 (GRCm39) I212T probably benign Het
Ccdc63 A T 5: 122,255,107 (GRCm39) probably benign Het
Chst1 C A 2: 92,443,951 (GRCm39) P141Q probably damaging Het
Cped1 T A 6: 22,119,475 (GRCm39) F311L probably damaging Het
D6Wsu163e T A 6: 126,923,454 (GRCm39) H113Q probably benign Het
Dcn A T 10: 97,342,345 (GRCm39) probably benign Het
Dmbx1 C T 4: 115,775,309 (GRCm39) A324T probably benign Het
Dock10 G T 1: 80,490,171 (GRCm39) Q1618K probably damaging Het
Dpyd A G 3: 118,710,921 (GRCm39) E443G probably benign Het
Espl1 T C 15: 102,221,452 (GRCm39) V953A possibly damaging Het
Exosc10 T C 4: 148,647,213 (GRCm39) L174P probably damaging Het
Foxg1 A G 12: 49,432,365 (GRCm39) Y366C probably damaging Het
Fxyd3 T C 7: 30,770,159 (GRCm39) probably benign Het
Gbp2 T C 3: 142,335,867 (GRCm39) V189A probably benign Het
Gins4 T C 8: 23,719,426 (GRCm39) probably benign Het
Gm12789 A G 4: 101,845,319 (GRCm39) T3A probably benign Het
Gnb1l T C 16: 18,366,839 (GRCm39) probably benign Het
Gtpbp3 T C 8: 71,944,141 (GRCm39) L295S probably damaging Het
Hrh4 C A 18: 13,155,455 (GRCm39) Y331* probably null Het
Hsd11b1 A T 1: 192,923,705 (GRCm39) Y52N probably damaging Het
Jam3 A G 9: 27,017,701 (GRCm39) I29T probably benign Het
Kctd16 T A 18: 40,663,930 (GRCm39) I353N probably benign Het
Lama4 G T 10: 38,904,635 (GRCm39) G246C probably damaging Het
Lhx3 T A 2: 26,093,040 (GRCm39) M137L probably benign Het
Morc2a T C 11: 3,628,567 (GRCm39) I340T probably benign Het
Myo7a A C 7: 97,703,831 (GRCm39) I1969S probably benign Het
Or14a258 T C 7: 86,035,475 (GRCm39) E131G possibly damaging Het
Or5b116 T A 19: 13,422,792 (GRCm39) C139S probably damaging Het
Or6n1 A G 1: 173,916,732 (GRCm39) N42S probably damaging Het
Pclo T C 5: 14,731,194 (GRCm39) L3232P unknown Het
Ppip5k2 A G 1: 97,656,722 (GRCm39) V817A probably damaging Het
Rbfox3 T C 11: 118,386,066 (GRCm39) T280A probably benign Het
Rfx3 T C 19: 27,771,188 (GRCm39) D521G probably benign Het
Scn5a C T 9: 119,372,201 (GRCm39) V223I probably damaging Het
Sgsm3 T G 15: 80,890,803 (GRCm39) M119R probably damaging Het
Slc6a7 T A 18: 61,129,783 (GRCm39) M608L probably benign Het
Slit2 A G 5: 48,339,673 (GRCm39) probably benign Het
Steap2 T A 5: 5,723,561 (GRCm39) I440F probably benign Het
Syn2 T G 6: 115,231,111 (GRCm39) probably benign Het
Taar2 G A 10: 23,817,393 (GRCm39) R311H probably benign Het
Tfb2m G A 1: 179,361,203 (GRCm39) H262Y probably benign Het
Trmt1l A G 1: 151,333,426 (GRCm39) probably benign Het
Trpm6 C A 19: 18,800,742 (GRCm39) P819T probably benign Het
Ttn G A 2: 76,574,033 (GRCm39) A25620V probably damaging Het
Ubn2 T C 6: 38,459,553 (GRCm39) probably null Het
Vars1 T C 17: 35,230,572 (GRCm39) probably benign Het
Vip A T 10: 5,594,004 (GRCm39) D119V possibly damaging Het
Vmn2r92 C T 17: 18,388,219 (GRCm39) A408V probably damaging Het
Vps33b T C 7: 79,935,802 (GRCm39) I405T possibly damaging Het
Zbtb21 T A 16: 97,753,300 (GRCm39) S356C probably damaging Het
Zdhhc6 A T 19: 55,297,362 (GRCm39) S237T probably benign Het
Zfp142 G A 1: 74,615,223 (GRCm39) A427V probably benign Het
Zfp692 T A 11: 58,205,140 (GRCm39) V463E possibly damaging Het
Zmynd8 A T 2: 165,670,322 (GRCm39) I384N probably damaging Het
Other mutations in Polr1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Polr1a APN 6 71,925,470 (GRCm39) missense probably benign 0.32
IGL01834:Polr1a APN 6 71,925,446 (GRCm39) missense probably benign
IGL01902:Polr1a APN 6 71,940,732 (GRCm39) missense probably damaging 1.00
IGL02101:Polr1a APN 6 71,927,786 (GRCm39) missense probably benign 0.00
IGL02325:Polr1a APN 6 71,897,641 (GRCm39) missense probably benign 0.38
IGL02398:Polr1a APN 6 71,913,540 (GRCm39) splice site probably benign
IGL02528:Polr1a APN 6 71,941,701 (GRCm39) missense probably benign
IGL02555:Polr1a APN 6 71,897,441 (GRCm39) missense probably damaging 0.98
IGL02613:Polr1a APN 6 71,944,304 (GRCm39) missense probably damaging 1.00
IGL02693:Polr1a APN 6 71,940,830 (GRCm39) splice site probably benign
IGL02892:Polr1a APN 6 71,908,680 (GRCm39) missense possibly damaging 0.70
IGL03059:Polr1a APN 6 71,913,496 (GRCm39) missense probably benign
IGL03174:Polr1a APN 6 71,954,331 (GRCm39) missense possibly damaging 0.82
D4043:Polr1a UTSW 6 71,918,401 (GRCm39) missense possibly damaging 0.92
R0092:Polr1a UTSW 6 71,944,439 (GRCm39) splice site probably benign
R0217:Polr1a UTSW 6 71,940,687 (GRCm39) missense probably benign 0.19
R0329:Polr1a UTSW 6 71,943,400 (GRCm39) missense possibly damaging 0.96
R0330:Polr1a UTSW 6 71,943,400 (GRCm39) missense possibly damaging 0.96
R0352:Polr1a UTSW 6 71,897,747 (GRCm39) splice site probably benign
R0411:Polr1a UTSW 6 71,955,405 (GRCm39) missense possibly damaging 0.95
R0446:Polr1a UTSW 6 71,927,648 (GRCm39) critical splice donor site probably null
R0846:Polr1a UTSW 6 71,901,627 (GRCm39) missense probably damaging 1.00
R1035:Polr1a UTSW 6 71,944,900 (GRCm39) missense probably benign
R1294:Polr1a UTSW 6 71,889,886 (GRCm39) missense probably damaging 0.99
R1460:Polr1a UTSW 6 71,918,368 (GRCm39) missense probably damaging 0.99
R1657:Polr1a UTSW 6 71,918,519 (GRCm39) missense probably damaging 1.00
R1846:Polr1a UTSW 6 71,953,172 (GRCm39) missense probably damaging 0.98
R1862:Polr1a UTSW 6 71,886,187 (GRCm39) missense probably damaging 0.96
R1865:Polr1a UTSW 6 71,943,508 (GRCm39) missense probably damaging 1.00
R1903:Polr1a UTSW 6 71,944,898 (GRCm39) missense probably benign 0.02
R1937:Polr1a UTSW 6 71,913,536 (GRCm39) critical splice donor site probably null
R2063:Polr1a UTSW 6 71,913,269 (GRCm39) splice site probably null
R2071:Polr1a UTSW 6 71,953,058 (GRCm39) missense possibly damaging 0.64
R2084:Polr1a UTSW 6 71,927,793 (GRCm39) missense possibly damaging 0.69
R2377:Polr1a UTSW 6 71,949,810 (GRCm39) critical splice donor site probably null
R2410:Polr1a UTSW 6 71,951,866 (GRCm39) missense probably benign
R3001:Polr1a UTSW 6 71,890,000 (GRCm39) missense probably benign 0.01
R3001:Polr1a UTSW 6 71,942,628 (GRCm39) missense probably benign 0.02
R3002:Polr1a UTSW 6 71,942,628 (GRCm39) missense probably benign 0.02
R3002:Polr1a UTSW 6 71,890,000 (GRCm39) missense probably benign 0.01
R3924:Polr1a UTSW 6 71,906,434 (GRCm39) missense probably benign 0.00
R4105:Polr1a UTSW 6 71,953,175 (GRCm39) missense probably damaging 0.98
R4125:Polr1a UTSW 6 71,942,690 (GRCm39) missense probably benign 0.00
R4271:Polr1a UTSW 6 71,930,006 (GRCm39) missense probably benign 0.02
R4440:Polr1a UTSW 6 71,927,832 (GRCm39) missense probably damaging 0.98
R4667:Polr1a UTSW 6 71,894,805 (GRCm39) missense probably benign 0.30
R4769:Polr1a UTSW 6 71,927,852 (GRCm39) missense probably benign 0.01
R4801:Polr1a UTSW 6 71,953,054 (GRCm39) missense probably benign 0.00
R4802:Polr1a UTSW 6 71,953,054 (GRCm39) missense probably benign 0.00
R4828:Polr1a UTSW 6 71,943,385 (GRCm39) missense possibly damaging 0.93
R4911:Polr1a UTSW 6 71,886,213 (GRCm39) missense possibly damaging 0.67
R5071:Polr1a UTSW 6 71,908,693 (GRCm39) missense possibly damaging 0.71
R5165:Polr1a UTSW 6 71,944,909 (GRCm39) missense probably damaging 1.00
R5223:Polr1a UTSW 6 71,944,891 (GRCm39) missense possibly damaging 0.73
R5239:Polr1a UTSW 6 71,890,021 (GRCm39) missense probably damaging 1.00
R5546:Polr1a UTSW 6 71,906,350 (GRCm39) missense possibly damaging 0.64
R5599:Polr1a UTSW 6 71,944,346 (GRCm39) missense possibly damaging 0.95
R5696:Polr1a UTSW 6 71,906,410 (GRCm39) missense probably benign 0.05
R5850:Polr1a UTSW 6 71,903,667 (GRCm39) missense probably benign 0.00
R6274:Polr1a UTSW 6 71,931,874 (GRCm39) splice site probably null
R6526:Polr1a UTSW 6 71,906,427 (GRCm39) missense possibly damaging 0.89
R6578:Polr1a UTSW 6 71,953,025 (GRCm39) missense possibly damaging 0.93
R6660:Polr1a UTSW 6 71,944,358 (GRCm39) missense probably damaging 0.98
R6892:Polr1a UTSW 6 71,941,696 (GRCm39) missense possibly damaging 0.72
R7274:Polr1a UTSW 6 71,897,500 (GRCm39) nonsense probably null
R7291:Polr1a UTSW 6 71,918,440 (GRCm39) missense probably benign 0.02
R7311:Polr1a UTSW 6 71,927,863 (GRCm39) missense possibly damaging 0.53
R7431:Polr1a UTSW 6 71,903,643 (GRCm39) missense probably benign 0.14
R7479:Polr1a UTSW 6 71,913,281 (GRCm39) missense probably damaging 1.00
R7607:Polr1a UTSW 6 71,890,005 (GRCm39) missense probably benign
R7739:Polr1a UTSW 6 71,931,819 (GRCm39) missense possibly damaging 0.94
R7746:Polr1a UTSW 6 71,918,496 (GRCm39) missense probably damaging 1.00
R7764:Polr1a UTSW 6 71,930,054 (GRCm39) missense probably damaging 1.00
R7835:Polr1a UTSW 6 71,892,126 (GRCm39) missense probably benign 0.02
R8029:Polr1a UTSW 6 71,889,940 (GRCm39) nonsense probably null
R8057:Polr1a UTSW 6 71,908,644 (GRCm39) missense possibly damaging 0.95
R8144:Polr1a UTSW 6 71,927,600 (GRCm39) missense probably benign
R8170:Polr1a UTSW 6 71,897,733 (GRCm39) missense probably benign
R8320:Polr1a UTSW 6 71,918,368 (GRCm39) missense probably damaging 0.99
R8328:Polr1a UTSW 6 71,897,718 (GRCm39) missense probably benign
R8331:Polr1a UTSW 6 71,953,163 (GRCm39) missense probably damaging 1.00
R8362:Polr1a UTSW 6 71,941,651 (GRCm39) missense probably benign 0.00
R8511:Polr1a UTSW 6 71,897,504 (GRCm39) missense probably benign 0.01
R8709:Polr1a UTSW 6 71,951,832 (GRCm39) missense probably benign
R8745:Polr1a UTSW 6 71,931,755 (GRCm39) missense probably damaging 1.00
R8784:Polr1a UTSW 6 71,927,612 (GRCm39) missense probably benign
R9055:Polr1a UTSW 6 71,892,053 (GRCm39) missense possibly damaging 0.46
R9088:Polr1a UTSW 6 71,908,767 (GRCm39) missense probably benign 0.26
R9211:Polr1a UTSW 6 71,943,521 (GRCm39) missense probably damaging 1.00
R9228:Polr1a UTSW 6 71,931,755 (GRCm39) missense probably damaging 1.00
R9240:Polr1a UTSW 6 71,940,661 (GRCm39) nonsense probably null
R9267:Polr1a UTSW 6 71,942,542 (GRCm39) missense probably benign
R9302:Polr1a UTSW 6 71,901,683 (GRCm39) critical splice donor site probably null
R9744:Polr1a UTSW 6 71,906,372 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGTCCTGAGAGTGATGCAGACACC -3'
(R):5'- CATCAAGAGGTACGCTGGACAGAC -3'

Sequencing Primer
(F):5'- AGCAAACCCATTGCTCTGTATG -3'
(R):5'- ATTTCTGGTGGGTTCCCAGT -3'
Posted On 2013-05-09