Incidental Mutation 'R4679:Bsn'
ID 349935
Institutional Source Beutler Lab
Gene Symbol Bsn
Ensembl Gene ENSMUSG00000032589
Gene Name bassoon
Synonyms presynaptic cytomatrix protein
MMRRC Submission 041932-MU
Accession Numbers

Genbank: NM_007567; MGI: 1277955
Essential gene? Probably non essential (E-score: 0.248) question?
Stock # R4679 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 108096022-108190384 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 108110130 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 2808 (S2808P)
Ref Sequence ENSEMBL: ENSMUSP00000035208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035208]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000035208
AA Change: S2808P
SMART Domains Protein: ENSMUSP00000035208
Gene: ENSMUSG00000032589
AA Change: S2808P

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
low complexity region 42 77 N/A INTRINSIC
Pfam:zf-piccolo 165 223 6.1e-30 PFAM
low complexity region 394 409 N/A INTRINSIC
low complexity region 445 454 N/A INTRINSIC
Pfam:zf-piccolo 462 520 5.2e-31 PFAM
low complexity region 527 540 N/A INTRINSIC
low complexity region 627 643 N/A INTRINSIC
low complexity region 664 681 N/A INTRINSIC
low complexity region 694 708 N/A INTRINSIC
low complexity region 788 803 N/A INTRINSIC
low complexity region 994 1021 N/A INTRINSIC
coiled coil region 1047 1101 N/A INTRINSIC
low complexity region 1131 1145 N/A INTRINSIC
low complexity region 1173 1190 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1333 1343 N/A INTRINSIC
low complexity region 1443 1455 N/A INTRINSIC
low complexity region 1481 1498 N/A INTRINSIC
low complexity region 1790 1800 N/A INTRINSIC
low complexity region 2117 2126 N/A INTRINSIC
low complexity region 2287 2303 N/A INTRINSIC
low complexity region 2326 2356 N/A INTRINSIC
SCOP:d1eq1a_ 2362 2477 2e-7 SMART
low complexity region 2607 2614 N/A INTRINSIC
low complexity region 2635 2651 N/A INTRINSIC
low complexity region 2655 2672 N/A INTRINSIC
coiled coil region 2949 2990 N/A INTRINSIC
low complexity region 3057 3071 N/A INTRINSIC
low complexity region 3089 3114 N/A INTRINSIC
low complexity region 3446 3461 N/A INTRINSIC
low complexity region 3520 3534 N/A INTRINSIC
low complexity region 3653 3666 N/A INTRINSIC
low complexity region 3750 3820 N/A INTRINSIC
low complexity region 3831 3852 N/A INTRINSIC
low complexity region 3856 3901 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000124763
AA Change: S95P
Meta Mutation Damage Score 0.1022 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 98% (112/114)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurotransmitters are released from a specific site in the axon terminal called the active zone, which is composed of synaptic vesicles and a meshwork of cytoskeleton underlying the plasma membrane. The protein encoded by this gene is thought to be a scaffolding protein involved in organizing the presynaptic cytoskeleton. The gene is expressed primarily in neurons in the brain. A similar gene product in rodents is concentrated in the active zone of axon terminals and tightly associated with cytoskeletal structures, and is essential for regulating neurotransmitter release from a subset of synapses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants lacking functional protein exhibit impaired hippocampal and photoreceptor synaptic transmission, aberrant photoreceptor ribbon synapse formation, and spontaneous epileptic seizures. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, other(1) Gene trapped(8)
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik C T 4: 35,226,033 probably benign Het
AA986860 T A 1: 130,742,403 S121T possibly damaging Het
Abcb9 A G 5: 124,078,804 V450A probably benign Het
Abcg1 A T 17: 31,114,261 R659S probably benign Het
Acad9 A T 3: 36,088,840 N508I possibly damaging Het
Acrbp T A 6: 125,060,918 C393S probably damaging Het
Adcy7 T C 8: 88,317,937 V486A probably benign Het
Adgrf1 G T 17: 43,310,493 L540F probably damaging Het
Ap5m1 T C 14: 49,078,828 I285T probably benign Het
Arhgap27 G T 11: 103,360,949 probably benign Het
Armc5 A T 7: 128,240,104 E198V possibly damaging Het
Atp8b5 A T 4: 43,365,955 K742M probably benign Het
Atp9a T G 2: 168,661,964 T603P possibly damaging Het
Catsper4 T C 4: 134,226,605 N81S probably damaging Het
Ccl17 C G 8: 94,810,500 T10S probably benign Het
Cdc123 A T 2: 5,844,892 V6D probably damaging Het
Cdca2 T C 14: 67,714,966 K14E possibly damaging Het
Cdh3 C A 8: 106,539,856 T302K probably damaging Het
Cdh9 A G 15: 16,850,959 M605V probably benign Het
Cdk4 A G 10: 127,064,911 E144G possibly damaging Het
Clasp1 C T 1: 118,543,271 A879V probably damaging Het
Cldn8 G A 16: 88,562,408 H210Y probably benign Het
Cntn5 T C 9: 9,970,531 D518G probably benign Het
Cog1 C T 11: 113,652,290 A208V probably damaging Het
Col4a2 T A 8: 11,431,337 H836Q possibly damaging Het
Copb1 T C 7: 114,248,976 D108G probably damaging Het
Csmd3 A T 15: 48,161,083 Y600* probably null Het
Cyb5r1 T A 1: 134,407,833 H164Q probably benign Het
Dkc1 A G X: 75,100,992 I215V probably benign Het
Enpep A G 3: 129,303,713 probably null Het
Fam71b T A 11: 46,404,813 M4K possibly damaging Het
Fbln7 A G 2: 128,894,886 Y311C probably damaging Het
Fign A C 2: 63,979,261 L555R probably damaging Het
Fkbp7 A T 2: 76,671,688 probably benign Het
Fmn2 T C 1: 174,503,162 S373P unknown Het
Frmd4b C T 6: 97,295,666 D868N possibly damaging Het
Gfpt2 A G 11: 49,823,737 N321S probably benign Het
Glmn G T 5: 107,561,075 T372K probably damaging Het
Gm26602 C T 10: 79,910,974 probably benign Het
Gm6797 A G X: 8,639,694 noncoding transcript Het
Gpat3 T A 5: 100,893,456 F383L probably damaging Het
Grrp1 A G 4: 134,251,436 S244P probably damaging Het
H2-M11 C T 17: 36,548,150 T194I possibly damaging Het
Hcn1 C T 13: 117,657,015 H268Y probably benign Het
Hectd4 G T 5: 121,325,251 C2345F possibly damaging Het
Htt A G 5: 34,820,080 D770G probably benign Het
Ints3 T C 3: 90,408,510 T316A possibly damaging Het
Ipo9 A G 1: 135,394,169 F608L probably benign Het
Irak1 A C X: 74,022,389 probably benign Het
Jam2 G A 16: 84,812,952 V151M probably damaging Het
Lag3 T A 6: 124,904,545 Q488L possibly damaging Het
Large2 A T 2: 92,367,558 L266Q probably benign Het
Lrp3 T G 7: 35,203,940 D327A probably damaging Het
Mamstr C A 7: 45,644,692 probably benign Het
Mettl14 G A 3: 123,369,414 probably benign Het
Miga1 A G 3: 152,322,475 V139A probably damaging Het
Mthfd2l A C 5: 90,948,911 R130S probably benign Het
Myo1b A G 1: 51,757,973 I970T possibly damaging Het
Nat10 C A 2: 103,732,170 W607L probably damaging Het
Nop56 A G 2: 130,278,273 T183A probably benign Het
Olfr1258 A G 2: 89,930,664 Y285C possibly damaging Het
Olfr239 A G 17: 33,199,393 H115R probably benign Het
Olfr291 T A 7: 84,856,904 Y178* probably null Het
Olfr464 T A 11: 87,914,310 M199L probably benign Het
Olfr592 A G 7: 103,187,102 Y167C probably benign Het
Olfr710 A T 7: 106,944,945 S19T probably benign Het
Pcdhb12 T C 18: 37,436,949 F383L probably damaging Het
Pde4dip C A 3: 97,695,005 D2252Y probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Plscr2 T G 9: 92,287,770 L91R probably benign Het
Plxnc1 T A 10: 94,794,444 Y1531F probably damaging Het
Ptprq A T 10: 107,685,182 F710I probably benign Het
Rad51ap2 A G 12: 11,456,551 E158G probably damaging Het
Rasip1 T A 7: 45,627,823 H18Q possibly damaging Het
Rcsd1 T A 1: 165,655,924 N166I probably damaging Het
Ripor1 T A 8: 105,617,785 I517K possibly damaging Het
Ryr2 T A 13: 11,824,369 H506L probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sept14 T C 5: 129,693,026 D202G possibly damaging Het
Siglec1 A T 2: 131,073,411 L1420Q possibly damaging Het
Slc22a29 T A 19: 8,161,584 I505F possibly damaging Het
Sorcs1 T A 19: 50,182,669 Y927F probably benign Het
Spats2 T G 15: 99,180,722 M191R possibly damaging Het
Sycp1 C T 3: 102,922,462 probably null Het
T2 A G 17: 8,391,016 E99G possibly damaging Het
Taf3 G A 2: 10,048,564 probably benign Het
Tnfsf10 A T 3: 27,335,579 N263I probably damaging Het
Treml2 A T 17: 48,308,175 R229S probably benign Het
Trmt13 T C 3: 116,589,755 K125E probably damaging Het
Ttc9 G T 12: 81,631,601 C66F probably damaging Het
Vmn2r63 C T 7: 42,928,120 M331I probably benign Het
Zfp353-ps T C 8: 42,082,214 noncoding transcript Het
Zfp932 A T 5: 110,009,894 H486L probably damaging Het
Other mutations in Bsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Bsn APN 9 108115110 missense probably benign 0.01
IGL00330:Bsn APN 9 108115340 missense probably damaging 1.00
IGL00863:Bsn APN 9 108115322 missense probably damaging 1.00
IGL01123:Bsn APN 9 108115986 missense probably damaging 1.00
IGL01330:Bsn APN 9 108110913 unclassified probably benign
IGL01336:Bsn APN 9 108111785 missense probably damaging 0.99
IGL01399:Bsn APN 9 108107187 missense unknown
IGL01683:Bsn APN 9 108114896 missense possibly damaging 0.71
IGL02022:Bsn APN 9 108110418 unclassified probably benign
IGL02396:Bsn APN 9 108116046 missense possibly damaging 0.90
IGL02538:Bsn APN 9 108105236 missense unknown
IGL02565:Bsn APN 9 108113288 missense probably damaging 0.99
IGL02661:Bsn APN 9 108106936 nonsense probably null
IGL02739:Bsn APN 9 108112546 missense probably benign 0.14
IGL02951:Bsn APN 9 108115613 missense probably damaging 1.00
IGL02987:Bsn APN 9 108126304 missense probably benign 0.03
IGL03033:Bsn APN 9 108115993 missense probably damaging 1.00
IGL03069:Bsn APN 9 108114263 missense probably damaging 1.00
IGL03076:Bsn APN 9 108105382 missense unknown
R0068:Bsn UTSW 9 108112137 missense probably damaging 1.00
R0068:Bsn UTSW 9 108112137 missense probably damaging 1.00
R0167:Bsn UTSW 9 108125986 missense probably benign 0.01
R0234:Bsn UTSW 9 108116396 missense possibly damaging 0.50
R0234:Bsn UTSW 9 108116396 missense possibly damaging 0.50
R0359:Bsn UTSW 9 108111846 missense possibly damaging 0.81
R0514:Bsn UTSW 9 108125782 missense probably benign 0.07
R0593:Bsn UTSW 9 108110306 missense unknown
R0617:Bsn UTSW 9 108107240 missense unknown
R0636:Bsn UTSW 9 108107834 missense unknown
R0652:Bsn UTSW 9 108105742 missense unknown
R0718:Bsn UTSW 9 108111360 unclassified probably benign
R0730:Bsn UTSW 9 108106812 missense unknown
R0905:Bsn UTSW 9 108105635 missense unknown
R0963:Bsn UTSW 9 108111807 missense possibly damaging 0.81
R0992:Bsn UTSW 9 108114354 nonsense probably null
R1101:Bsn UTSW 9 108116411 missense probably damaging 1.00
R1393:Bsn UTSW 9 108110517 unclassified probably benign
R1490:Bsn UTSW 9 108113994 missense probably benign 0.03
R1566:Bsn UTSW 9 108125985 missense probably benign 0.35
R1582:Bsn UTSW 9 108105092 missense unknown
R1738:Bsn UTSW 9 108106934 missense unknown
R1867:Bsn UTSW 9 108106719 missense unknown
R1918:Bsn UTSW 9 108107573 missense unknown
R1933:Bsn UTSW 9 108116444 missense possibly damaging 0.91
R1946:Bsn UTSW 9 108114651 missense probably damaging 0.99
R1978:Bsn UTSW 9 108114549 missense probably benign 0.35
R2068:Bsn UTSW 9 108110684 unclassified probably benign
R2068:Bsn UTSW 9 108126550 missense possibly damaging 0.95
R2113:Bsn UTSW 9 108114886 missense probably benign 0.14
R2136:Bsn UTSW 9 108113231 missense probably damaging 1.00
R2172:Bsn UTSW 9 108109992 intron probably benign
R2266:Bsn UTSW 9 108115124 missense probably damaging 1.00
R2293:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2294:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2368:Bsn UTSW 9 108111030 nonsense probably null
R2442:Bsn UTSW 9 108106920 missense unknown
R2507:Bsn UTSW 9 108116114 missense probably damaging 1.00
R2880:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2881:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2922:Bsn UTSW 9 108108186 missense unknown
R2922:Bsn UTSW 9 108115469 missense probably damaging 1.00
R3618:Bsn UTSW 9 108117561 critical splice acceptor site probably null
R3742:Bsn UTSW 9 108105739 missense unknown
R3825:Bsn UTSW 9 108106856 missense unknown
R3982:Bsn UTSW 9 108107166 missense unknown
R4094:Bsn UTSW 9 108113870 missense probably damaging 1.00
R4158:Bsn UTSW 9 108112946 missense possibly damaging 0.95
R4225:Bsn UTSW 9 108106733 missense unknown
R4261:Bsn UTSW 9 108110684 unclassified probably benign
R4482:Bsn UTSW 9 108114664 missense probably damaging 1.00
R4515:Bsn UTSW 9 108104078 splice site probably null
R4585:Bsn UTSW 9 108110463 unclassified probably benign
R4628:Bsn UTSW 9 108113235 missense probably damaging 1.00
R4636:Bsn UTSW 9 108115424 missense probably damaging 1.00
R4723:Bsn UTSW 9 108112655 missense probably benign 0.03
R4843:Bsn UTSW 9 108107189 missense unknown
R4885:Bsn UTSW 9 108107527 nonsense probably null
R4936:Bsn UTSW 9 108111761 missense probably damaging 1.00
R4942:Bsn UTSW 9 108106479 missense unknown
R4972:Bsn UTSW 9 108115178 missense probably damaging 1.00
R4992:Bsn UTSW 9 108115548 missense probably damaging 1.00
R5067:Bsn UTSW 9 108111953 missense probably damaging 1.00
R5206:Bsn UTSW 9 108105373 missense unknown
R5286:Bsn UTSW 9 108110924 unclassified probably benign
R5492:Bsn UTSW 9 108112515 missense probably damaging 0.98
R5553:Bsn UTSW 9 108110421 unclassified probably benign
R5561:Bsn UTSW 9 108105511 missense unknown
R5597:Bsn UTSW 9 108114932 missense probably benign 0.06
R5646:Bsn UTSW 9 108110432 unclassified probably benign
R5796:Bsn UTSW 9 108126024 missense probably damaging 1.00
R5801:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R5802:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R5850:Bsn UTSW 9 108114950 missense probably damaging 0.99
R5938:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R6221:Bsn UTSW 9 108105566 missense unknown
R6243:Bsn UTSW 9 108107561 missense unknown
R6254:Bsn UTSW 9 108111866 missense probably damaging 0.96
R6263:Bsn UTSW 9 108113254 missense probably damaging 1.00
R6345:Bsn UTSW 9 108107355 missense unknown
R6368:Bsn UTSW 9 108111314 unclassified probably benign
R6574:Bsn UTSW 9 108113954 missense possibly damaging 0.95
R6793:Bsn UTSW 9 108114615 nonsense probably null
R6802:Bsn UTSW 9 108110624 unclassified probably benign
R6943:Bsn UTSW 9 108107817 missense unknown
R6999:Bsn UTSW 9 108113433 missense probably benign 0.00
R7149:Bsn UTSW 9 108116321 nonsense probably null
R7199:Bsn UTSW 9 108115334 missense probably damaging 1.00
R7322:Bsn UTSW 9 108126421 nonsense probably null
R7349:Bsn UTSW 9 108110783 missense unknown
R7372:Bsn UTSW 9 108110519 missense unknown
R7373:Bsn UTSW 9 108113484 missense probably damaging 1.00
R7413:Bsn UTSW 9 108139491 missense possibly damaging 0.61
R7473:Bsn UTSW 9 108112250 missense probably damaging 1.00
R7482:Bsn UTSW 9 108113529 missense probably damaging 0.98
R7530:Bsn UTSW 9 108111956 missense probably damaging 1.00
R7549:Bsn UTSW 9 108114815 missense probably benign 0.05
R7570:Bsn UTSW 9 108113543 missense probably damaging 1.00
R7635:Bsn UTSW 9 108110990 missense unknown
R7696:Bsn UTSW 9 108114501 missense probably damaging 1.00
R7757:Bsn UTSW 9 108114740 missense possibly damaging 0.90
R7868:Bsn UTSW 9 108114899 missense possibly damaging 0.95
R7897:Bsn UTSW 9 108111866 missense probably damaging 0.98
R7960:Bsn UTSW 9 108115548 missense probably damaging 1.00
R8022:Bsn UTSW 9 108114404 missense probably benign 0.01
R8056:Bsn UTSW 9 108105307 missense
R8158:Bsn UTSW 9 108110033 missense unknown
R8161:Bsn UTSW 9 108139530 missense probably benign 0.20
R8225:Bsn UTSW 9 108107106 missense
R8282:Bsn UTSW 9 108107691 missense possibly damaging 0.73
R8296:Bsn UTSW 9 108117379 missense probably benign 0.00
R8415:Bsn UTSW 9 108111452 missense probably benign 0.00
R8417:Bsn UTSW 9 108111452 missense probably benign 0.00
R8426:Bsn UTSW 9 108126573 missense probably damaging 1.00
R8437:Bsn UTSW 9 108111452 missense probably benign 0.00
R8438:Bsn UTSW 9 108111452 missense probably benign 0.00
R8439:Bsn UTSW 9 108111452 missense probably benign 0.00
R8440:Bsn UTSW 9 108111452 missense probably benign 0.00
R8441:Bsn UTSW 9 108111452 missense probably benign 0.00
R8442:Bsn UTSW 9 108111452 missense probably benign 0.00
R8513:Bsn UTSW 9 108114510 missense possibly damaging 0.65
R8529:Bsn UTSW 9 108111452 missense probably benign 0.00
R8535:Bsn UTSW 9 108111452 missense probably benign 0.00
R8546:Bsn UTSW 9 108111452 missense probably benign 0.00
R8548:Bsn UTSW 9 108111452 missense probably benign 0.00
R8549:Bsn UTSW 9 108111452 missense probably benign 0.00
R8682:Bsn UTSW 9 108106169 missense
R8773:Bsn UTSW 9 108110505 missense unknown
R8883:Bsn UTSW 9 108113028 missense probably damaging 0.98
R8906:Bsn UTSW 9 108107553 missense unknown
R9018:Bsn UTSW 9 108117289 missense probably benign 0.06
R9070:Bsn UTSW 9 108110096 missense
R9094:Bsn UTSW 9 108110853 missense unknown
R9098:Bsn UTSW 9 108112974 missense possibly damaging 0.65
R9128:Bsn UTSW 9 108116150 missense probably benign 0.21
R9162:Bsn UTSW 9 108110684 missense unknown
R9224:Bsn UTSW 9 108105487 missense
R9230:Bsn UTSW 9 108112260 missense probably damaging 1.00
R9233:Bsn UTSW 9 108117090 missense probably benign 0.28
R9245:Bsn UTSW 9 108116093 missense probably damaging 1.00
R9275:Bsn UTSW 9 108111620 missense probably damaging 1.00
R9307:Bsn UTSW 9 108115794 missense probably benign 0.01
R9343:Bsn UTSW 9 108115502 missense probably damaging 1.00
R9377:Bsn UTSW 9 108113601 missense probably damaging 1.00
R9377:Bsn UTSW 9 108116162 missense probably damaging 1.00
R9378:Bsn UTSW 9 108107655 missense possibly damaging 0.85
R9408:Bsn UTSW 9 108139453 nonsense probably null
R9455:Bsn UTSW 9 108111332 missense unknown
R9563:Bsn UTSW 9 108107417 missense
R9615:Bsn UTSW 9 108107231 missense
R9656:Bsn UTSW 9 108117208 missense probably benign 0.09
R9698:Bsn UTSW 9 108115971 missense probably damaging 1.00
X0028:Bsn UTSW 9 108113504 missense probably damaging 1.00
X0066:Bsn UTSW 9 108139210 missense probably damaging 1.00
Z1177:Bsn UTSW 9 108105499 missense
Z1177:Bsn UTSW 9 108139195 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAATCTCTCTTTGGCAGACTCC -3'
(R):5'- TAGGACCAACTGCCATCAGC -3'

Sequencing Primer
(F):5'- TTTGGCAGACTCCTCGGC -3'
(R):5'- ATCAGCCCCTACCTACCTGG -3'
Posted On 2015-10-08