Mutagenetix > Incidental Mutations

Incidental Mutation 'R4679:Cdk4'

349939

Institutional Source

Beutler Lab

Gene Symbol

Cdk4

Ensembl Gene

ENSMUSG00000006728

Gene Name

cyclin-dependent kinase 4

Synonyms

Crk3, p34/cdk4

MMRRC Submission

041932-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.916) question?

Stock #

R4679 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

127063534-127067920 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 127064911 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 144 (E144G)

Ref Sequence

ENSEMBL: ENSMUSP00000117234 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006911] [ENSMUST00000040307] [ENSMUST00000060991] [ENSMUST00000120226] [ENSMUST00000125682] [ENSMUST00000133115] [ENSMUST00000142558]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000006911
AA Change: E144G

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000006911
Gene: ENSMUSG00000006728
AA Change: E144G

Domain	Start	End	E-Value	Type
S_TKc	6	295	9.2e-96	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000040307

SMART Domains

Protein: ENSMUSP00000041581
Gene: ENSMUSG00000040502

Domain	Start	End	E-Value	Type
low complexity region	20	45	N/A	INTRINSIC
low complexity region	50	60	N/A	INTRINSIC
low complexity region	76	105	N/A	INTRINSIC
RINGv	109	156	7.51e-18	SMART
transmembrane domain	183	205	N/A	INTRINSIC
Blast:AAA	211	238	2e-9	BLAST
low complexity region	267	284	N/A	INTRINSIC
low complexity region	291	302	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000060991

SMART Domains

Protein: ENSMUSP00000057751
Gene: ENSMUSG00000006736

Domain	Start	End	E-Value	Type
Pfam:Tetraspannin	8	200	1.2e-19	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000120226

SMART Domains

Protein: ENSMUSP00000112549
Gene: ENSMUSG00000006728

Domain	Start	End	E-Value	Type
Pfam:Pkinase	6	103	6e-10	PFAM
low complexity region	121	138	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123456

Predicted Effect

possibly damaging
Transcript: ENSMUST00000125682
AA Change: E144G

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000117234
Gene: ENSMUSG00000006728
AA Change: E144G

Domain	Start	End	E-Value	Type
S_TKc	6	261	5.19e-72	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000133115
AA Change: E144G

PolyPhen 2 Score 0.359 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000122973
Gene: ENSMUSG00000006728
AA Change: E144G

Domain	Start	End	E-Value	Type
S_TKc	6	250	1.55e-70	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135179

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140254

Predicted Effect

probably benign
Transcript: ENSMUST00000142558

SMART Domains

Protein: ENSMUSP00000116190
Gene: ENSMUSG00000006728

Domain	Start	End	E-Value	Type
Pfam:Pkinase	6	74	1.6e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145670

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217875

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218488

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218603

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220344

Meta Mutation Damage Score

0.4808

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.9%

Validation Efficiency

98% (112/114)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Ser/Thr protein kinase family. This protein is highly similar to the gene products of S. cerevisiae cdc28 and S. pombe cdc2. It is a catalytic subunit of the protein kinase complex that is important for cell cycle G1 phase progression. The activity of this kinase is restricted to the G1-S phase, which is controlled by the regulatory subunits D-type cyclins and CDK inhibitor p16(INK4a). This kinase was shown to be responsible for the phosphorylation of retinoblastoma gene product (Rb). Mutations in this gene as well as in its related proteins including D-type cyclins, p16(INK4a) and Rb were all found to be associated with tumorigenesis of a variety of cancers. Multiple polyadenylation sites of this gene have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have small size, insulin-deficient diabetes, sterility in females; near-sterility in males and impaired prolactin secretion due to hypoplastic pituitary development. Locomotor and endocrine gland defects are seen with some alleles. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110043O21Rik	C	T	4: 35,226,033		probably benign	Het
AA986860	T	A	1: 130,742,403	S121T	possibly damaging	Het
Abcb9	A	G	5: 124,078,804	V450A	probably benign	Het
Abcg1	A	T	17: 31,114,261	R659S	probably benign	Het
Acad9	A	T	3: 36,088,840	N508I	possibly damaging	Het
Acrbp	T	A	6: 125,060,918	C393S	probably damaging	Het
Adcy7	T	C	8: 88,317,937	V486A	probably benign	Het
Adgrf1	G	T	17: 43,310,493	L540F	probably damaging	Het
Ap5m1	T	C	14: 49,078,828	I285T	probably benign	Het
Arhgap27	G	T	11: 103,360,949		probably benign	Het
Armc5	A	T	7: 128,240,104	E198V	possibly damaging	Het
Atp8b5	A	T	4: 43,365,955	K742M	probably benign	Het
Atp9a	T	G	2: 168,661,964	T603P	possibly damaging	Het
Bsn	A	G	9: 108,110,130	S2808P	unknown	Het
Catsper4	T	C	4: 134,226,605	N81S	probably damaging	Het
Ccl17	C	G	8: 94,810,500	T10S	probably benign	Het
Cdc123	A	T	2: 5,844,892	V6D	probably damaging	Het
Cdca2	T	C	14: 67,714,966	K14E	possibly damaging	Het
Cdh3	C	A	8: 106,539,856	T302K	probably damaging	Het
Cdh9	A	G	15: 16,850,959	M605V	probably benign	Het
Clasp1	C	T	1: 118,543,271	A879V	probably damaging	Het
Cldn8	G	A	16: 88,562,408	H210Y	probably benign	Het
Cntn5	T	C	9: 9,970,531	D518G	probably benign	Het
Cog1	C	T	11: 113,652,290	A208V	probably damaging	Het
Col4a2	T	A	8: 11,431,337	H836Q	possibly damaging	Het
Copb1	T	C	7: 114,248,976	D108G	probably damaging	Het
Csmd3	A	T	15: 48,161,083	Y600*	probably null	Het
Cyb5r1	T	A	1: 134,407,833	H164Q	probably benign	Het
Dkc1	A	G	X: 75,100,992	I215V	probably benign	Het
Enpep	A	G	3: 129,303,713		probably null	Het
Fam71b	T	A	11: 46,404,813	M4K	possibly damaging	Het
Fbln7	A	G	2: 128,894,886	Y311C	probably damaging	Het
Fign	A	C	2: 63,979,261	L555R	probably damaging	Het
Fkbp7	A	T	2: 76,671,688		probably benign	Het
Fmn2	T	C	1: 174,503,162	S373P	unknown	Het
Frmd4b	C	T	6: 97,295,666	D868N	possibly damaging	Het
Gfpt2	A	G	11: 49,823,737	N321S	probably benign	Het
Glmn	G	T	5: 107,561,075	T372K	probably damaging	Het
Gm26602	C	T	10: 79,910,974		probably benign	Het
Gm6797	A	G	X: 8,639,694		noncoding transcript	Het
Gpat3	T	A	5: 100,893,456	F383L	probably damaging	Het
Grrp1	A	G	4: 134,251,436	S244P	probably damaging	Het
H2-M11	C	T	17: 36,548,150	T194I	possibly damaging	Het
Hcn1	C	T	13: 117,657,015	H268Y	probably benign	Het
Hectd4	G	T	5: 121,325,251	C2345F	possibly damaging	Het
Htt	A	G	5: 34,820,080	D770G	probably benign	Het
Ints3	T	C	3: 90,408,510	T316A	possibly damaging	Het
Ipo9	A	G	1: 135,394,169	F608L	probably benign	Het
Irak1	A	C	X: 74,022,389		probably benign	Het
Jam2	G	A	16: 84,812,952	V151M	probably damaging	Het
Lag3	T	A	6: 124,904,545	Q488L	possibly damaging	Het
Large2	A	T	2: 92,367,558	L266Q	probably benign	Het
Lrp3	T	G	7: 35,203,940	D327A	probably damaging	Het
Mamstr	C	A	7: 45,644,692		probably benign	Het
Mettl14	G	A	3: 123,369,414		probably benign	Het
Miga1	A	G	3: 152,322,475	V139A	probably damaging	Het
Mthfd2l	A	C	5: 90,948,911	R130S	probably benign	Het
Myo1b	A	G	1: 51,757,973	I970T	possibly damaging	Het
Nat10	C	A	2: 103,732,170	W607L	probably damaging	Het
Nop56	A	G	2: 130,278,273	T183A	probably benign	Het
Olfr1258	A	G	2: 89,930,664	Y285C	possibly damaging	Het
Olfr239	A	G	17: 33,199,393	H115R	probably benign	Het
Olfr291	T	A	7: 84,856,904	Y178*	probably null	Het
Olfr464	T	A	11: 87,914,310	M199L	probably benign	Het
Olfr592	A	G	7: 103,187,102	Y167C	probably benign	Het
Olfr710	A	T	7: 106,944,945	S19T	probably benign	Het
Pcdhb12	T	C	18: 37,436,949	F383L	probably damaging	Het
Pde4dip	C	A	3: 97,695,005	D2252Y	probably damaging	Het
Peg10	GC	GCTCC	6: 4,756,452		probably benign	Het
Plscr2	T	G	9: 92,287,770	L91R	probably benign	Het
Plxnc1	T	A	10: 94,794,444	Y1531F	probably damaging	Het
Ptprq	A	T	10: 107,685,182	F710I	probably benign	Het
Rad51ap2	A	G	12: 11,456,551	E158G	probably damaging	Het
Rasip1	T	A	7: 45,627,823	H18Q	possibly damaging	Het
Rcsd1	T	A	1: 165,655,924	N166I	probably damaging	Het
Ripor1	T	A	8: 105,617,785	I517K	possibly damaging	Het
Ryr2	T	A	13: 11,824,369	H506L	probably benign	Het
Secisbp2l	C	T	2: 125,740,737	G933D	possibly damaging	Het
Sept14	T	C	5: 129,693,026	D202G	possibly damaging	Het
Siglec1	A	T	2: 131,073,411	L1420Q	possibly damaging	Het
Slc22a29	T	A	19: 8,161,584	I505F	possibly damaging	Het
Sorcs1	T	A	19: 50,182,669	Y927F	probably benign	Het
Spats2	T	G	15: 99,180,722	M191R	possibly damaging	Het
Sycp1	C	T	3: 102,922,462		probably null	Het
T2	A	G	17: 8,391,016	E99G	possibly damaging	Het
Taf3	G	A	2: 10,048,564		probably benign	Het
Tnfsf10	A	T	3: 27,335,579	N263I	probably damaging	Het
Treml2	A	T	17: 48,308,175	R229S	probably benign	Het
Trmt13	T	C	3: 116,589,755	K125E	probably damaging	Het
Ttc9	G	T	12: 81,631,601	C66F	probably damaging	Het
Vmn2r63	C	T	7: 42,928,120	M331I	probably benign	Het
Zfp353-ps	T	C	8: 42,082,214		noncoding transcript	Het
Zfp932	A	T	5: 110,009,894	H486L	probably damaging	Het

Other mutations in Cdk4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00960:Cdk4	APN	10	127064297	missense	probably damaging	1.00
IGL01326:Cdk4	APN	10	127064623	missense	possibly damaging	0.95
R0140:Cdk4	UTSW	10	127064345	missense	probably damaging	1.00
R0799:Cdk4	UTSW	10	127064994	missense	probably damaging	0.98
R1437:Cdk4	UTSW	10	127064689	missense	probably damaging	1.00
R1575:Cdk4	UTSW	10	127064651	missense	probably damaging	1.00
R1656:Cdk4	UTSW	10	127064980	missense	probably benign	0.00
R1761:Cdk4	UTSW	10	127064677	splice site	probably null
R2567:Cdk4	UTSW	10	127064276	missense	probably benign	0.01
R4790:Cdk4	UTSW	10	127064701	missense	probably damaging	1.00
R4897:Cdk4	UTSW	10	127064575	intron	probably benign
R4946:Cdk4	UTSW	10	127064890	splice site	probably null
R5755:Cdk4	UTSW	10	127064722	critical splice donor site	probably null
R6515:Cdk4	UTSW	10	127066183	missense	probably null	0.06
R6868:Cdk4	UTSW	10	127065001	missense	probably benign	0.43
R7488:Cdk4	UTSW	10	127064237	start codon destroyed	probably null	0.26
R7748:Cdk4	UTSW	10	127064429	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- GCCGGTTGAGACCATTAAGG -3'
(R):5'- CTGGCTCTGAAAACTTCATGTAC -3'

Sequencing Primer
(F):5'- CCATTAAGGTGAGTAGGGGTG -3'
(R):5'- ACAAGACTCCTCAGTTGCTATGGG -3'

Posted On

2015-10-08