Incidental Mutation 'R4679:Rad51ap2'
ID 349945
Institutional Source Beutler Lab
Gene Symbol Rad51ap2
Ensembl Gene ENSMUSG00000086022
Gene Name RAD51 associated protein 2
Synonyms
MMRRC Submission 041932-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4679 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 11506080-11512929 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 11506552 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 158 (E158G)
Ref Sequence ENSEMBL: ENSMUSP00000128854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124065]
AlphaFold G3UW63
Predicted Effect probably damaging
Transcript: ENSMUST00000124065
AA Change: E158G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000128854
Gene: ENSMUSG00000086022
AA Change: E158G

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
low complexity region 428 438 N/A INTRINSIC
low complexity region 702 713 N/A INTRINSIC
Pfam:RAD51_interact 937 975 1.3e-20 PFAM
Meta Mutation Damage Score 0.0917 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 98% (112/114)
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 T A 1: 130,670,140 (GRCm39) S121T possibly damaging Het
Abcb9 A G 5: 124,216,867 (GRCm39) V450A probably benign Het
Abcg1 A T 17: 31,333,235 (GRCm39) R659S probably benign Het
Acad9 A T 3: 36,142,989 (GRCm39) N508I possibly damaging Het
Acrbp T A 6: 125,037,881 (GRCm39) C393S probably damaging Het
Adcy7 T C 8: 89,044,565 (GRCm39) V486A probably benign Het
Adgrf1 G T 17: 43,621,384 (GRCm39) L540F probably damaging Het
Ap5m1 T C 14: 49,316,285 (GRCm39) I285T probably benign Het
Arhgap27 G T 11: 103,251,775 (GRCm39) probably benign Het
Armc5 A T 7: 127,839,276 (GRCm39) E198V possibly damaging Het
Atp8b5 A T 4: 43,365,955 (GRCm39) K742M probably benign Het
Atp9a T G 2: 168,503,884 (GRCm39) T603P possibly damaging Het
Bsn A G 9: 107,987,329 (GRCm39) S2808P unknown Het
C9orf72 C T 4: 35,226,033 (GRCm39) probably benign Het
Catsper4 T C 4: 133,953,916 (GRCm39) N81S probably damaging Het
Ccl17 C G 8: 95,537,128 (GRCm39) T10S probably benign Het
Cdc123 A T 2: 5,849,703 (GRCm39) V6D probably damaging Het
Cdca2 T C 14: 67,952,415 (GRCm39) K14E possibly damaging Het
Cdh3 C A 8: 107,266,488 (GRCm39) T302K probably damaging Het
Cdh9 A G 15: 16,851,045 (GRCm39) M605V probably benign Het
Cdk4 A G 10: 126,900,780 (GRCm39) E144G possibly damaging Het
Clasp1 C T 1: 118,471,001 (GRCm39) A879V probably damaging Het
Cldn8 G A 16: 88,359,296 (GRCm39) H210Y probably benign Het
Cntn5 T C 9: 9,970,536 (GRCm39) D518G probably benign Het
Cog1 C T 11: 113,543,116 (GRCm39) A208V probably damaging Het
Col4a2 T A 8: 11,481,337 (GRCm39) H836Q possibly damaging Het
Copb1 T C 7: 113,848,211 (GRCm39) D108G probably damaging Het
Csmd3 A T 15: 48,024,479 (GRCm39) Y600* probably null Het
Cyb5r1 T A 1: 134,335,571 (GRCm39) H164Q probably benign Het
Dkc1 A G X: 74,144,598 (GRCm39) I215V probably benign Het
Enpep A G 3: 129,097,362 (GRCm39) probably null Het
Fam110d A G 4: 133,978,747 (GRCm39) S244P probably damaging Het
Fbln7 A G 2: 128,736,806 (GRCm39) Y311C probably damaging Het
Fign A C 2: 63,809,605 (GRCm39) L555R probably damaging Het
Fkbp7 A T 2: 76,502,032 (GRCm39) probably benign Het
Fmn2 T C 1: 174,330,728 (GRCm39) S373P unknown Het
Frmd4b C T 6: 97,272,627 (GRCm39) D868N possibly damaging Het
Garin3 T A 11: 46,295,640 (GRCm39) M4K possibly damaging Het
Gfpt2 A G 11: 49,714,564 (GRCm39) N321S probably benign Het
Glmn G T 5: 107,708,941 (GRCm39) T372K probably damaging Het
Gm26602 C T 10: 79,746,808 (GRCm39) probably benign Het
Gm6797 A G X: 8,505,933 (GRCm39) noncoding transcript Het
Gpat3 T A 5: 101,041,322 (GRCm39) F383L probably damaging Het
H2-M11 C T 17: 36,859,042 (GRCm39) T194I possibly damaging Het
Hcn1 C T 13: 117,793,551 (GRCm39) H268Y probably benign Het
Hectd4 G T 5: 121,463,314 (GRCm39) C2345F possibly damaging Het
Htt A G 5: 34,977,424 (GRCm39) D770G probably benign Het
Ints3 T C 3: 90,315,817 (GRCm39) T316A possibly damaging Het
Ipo9 A G 1: 135,321,907 (GRCm39) F608L probably benign Het
Irak1 A C X: 73,065,995 (GRCm39) probably benign Het
Jam2 G A 16: 84,609,840 (GRCm39) V151M probably damaging Het
Lag3 T A 6: 124,881,508 (GRCm39) Q488L possibly damaging Het
Large2 A T 2: 92,197,903 (GRCm39) L266Q probably benign Het
Lrp3 T G 7: 34,903,365 (GRCm39) D327A probably damaging Het
Mamstr C A 7: 45,294,116 (GRCm39) probably benign Het
Mettl14 G A 3: 123,163,063 (GRCm39) probably benign Het
Miga1 A G 3: 152,028,112 (GRCm39) V139A probably damaging Het
Mthfd2l A C 5: 91,096,770 (GRCm39) R130S probably benign Het
Myo1b A G 1: 51,797,132 (GRCm39) I970T possibly damaging Het
Nat10 C A 2: 103,562,515 (GRCm39) W607L probably damaging Het
Nop56 A G 2: 130,120,193 (GRCm39) T183A probably benign Het
Or10h1 A G 17: 33,418,367 (GRCm39) H115R probably benign Het
Or2d4 A T 7: 106,544,152 (GRCm39) S19T probably benign Het
Or4c10 A G 2: 89,761,008 (GRCm39) Y285C possibly damaging Het
Or4d1 T A 11: 87,805,136 (GRCm39) M199L probably benign Het
Or52j3 A G 7: 102,836,309 (GRCm39) Y167C probably benign Het
Or5ae2 T A 7: 84,506,112 (GRCm39) Y178* probably null Het
Pcdhb12 T C 18: 37,570,002 (GRCm39) F383L probably damaging Het
Pde4dip C A 3: 97,602,321 (GRCm39) D2252Y probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Plscr2 T G 9: 92,169,823 (GRCm39) L91R probably benign Het
Plxnc1 T A 10: 94,630,306 (GRCm39) Y1531F probably damaging Het
Ptprq A T 10: 107,521,043 (GRCm39) F710I probably benign Het
Rasip1 T A 7: 45,277,247 (GRCm39) H18Q possibly damaging Het
Rcsd1 T A 1: 165,483,493 (GRCm39) N166I probably damaging Het
Ripor1 T A 8: 106,344,417 (GRCm39) I517K possibly damaging Het
Ryr2 T A 13: 11,839,255 (GRCm39) H506L probably benign Het
Secisbp2l C T 2: 125,582,657 (GRCm39) G933D possibly damaging Het
Septin14 T C 5: 129,770,090 (GRCm39) D202G possibly damaging Het
Siglec1 A T 2: 130,915,331 (GRCm39) L1420Q possibly damaging Het
Slc22a29 T A 19: 8,138,948 (GRCm39) I505F possibly damaging Het
Sorcs1 T A 19: 50,171,107 (GRCm39) Y927F probably benign Het
Spats2 T G 15: 99,078,603 (GRCm39) M191R possibly damaging Het
Sycp1 C T 3: 102,829,778 (GRCm39) probably null Het
T2 A G 17: 8,609,848 (GRCm39) E99G possibly damaging Het
Taf3 G A 2: 10,053,375 (GRCm39) probably benign Het
Tnfsf10 A T 3: 27,389,728 (GRCm39) N263I probably damaging Het
Treml2 A T 17: 48,615,203 (GRCm39) R229S probably benign Het
Trmt13 T C 3: 116,383,404 (GRCm39) K125E probably damaging Het
Ttc9 G T 12: 81,678,375 (GRCm39) C66F probably damaging Het
Vmn2r63 C T 7: 42,577,544 (GRCm39) M331I probably benign Het
Zfp353-ps T C 8: 42,535,251 (GRCm39) noncoding transcript Het
Zfp932 A T 5: 110,157,760 (GRCm39) H486L probably damaging Het
Other mutations in Rad51ap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01879:Rad51ap2 APN 12 11,508,139 (GRCm39) missense probably benign 0.10
IGL01908:Rad51ap2 APN 12 11,508,592 (GRCm39) missense probably damaging 1.00
IGL02415:Rad51ap2 APN 12 11,506,930 (GRCm39) missense possibly damaging 0.91
IGL02731:Rad51ap2 APN 12 11,506,897 (GRCm39) missense probably damaging 0.99
IGL03407:Rad51ap2 APN 12 11,507,198 (GRCm39) missense possibly damaging 0.96
R0190:Rad51ap2 UTSW 12 11,508,540 (GRCm39) missense probably benign 0.01
R0281:Rad51ap2 UTSW 12 11,507,043 (GRCm39) missense possibly damaging 0.93
R0564:Rad51ap2 UTSW 12 11,507,897 (GRCm39) missense probably benign 0.20
R0674:Rad51ap2 UTSW 12 11,508,818 (GRCm39) critical splice donor site probably null
R0699:Rad51ap2 UTSW 12 11,507,601 (GRCm39) missense probably benign 0.03
R1033:Rad51ap2 UTSW 12 11,506,252 (GRCm39) missense probably damaging 0.98
R1255:Rad51ap2 UTSW 12 11,508,095 (GRCm39) missense possibly damaging 0.54
R1572:Rad51ap2 UTSW 12 11,507,113 (GRCm39) missense probably damaging 0.99
R1746:Rad51ap2 UTSW 12 11,507,776 (GRCm39) missense probably benign
R1882:Rad51ap2 UTSW 12 11,506,251 (GRCm39) missense possibly damaging 0.85
R2038:Rad51ap2 UTSW 12 11,507,025 (GRCm39) missense possibly damaging 0.73
R2151:Rad51ap2 UTSW 12 11,507,986 (GRCm39) missense probably benign 0.02
R2152:Rad51ap2 UTSW 12 11,507,986 (GRCm39) missense probably benign 0.02
R2154:Rad51ap2 UTSW 12 11,507,986 (GRCm39) missense probably benign 0.02
R2159:Rad51ap2 UTSW 12 11,507,752 (GRCm39) missense possibly damaging 0.87
R2321:Rad51ap2 UTSW 12 11,507,058 (GRCm39) missense probably damaging 1.00
R2355:Rad51ap2 UTSW 12 11,507,109 (GRCm39) missense probably benign
R2393:Rad51ap2 UTSW 12 11,507,798 (GRCm39) missense probably damaging 0.98
R2407:Rad51ap2 UTSW 12 11,508,502 (GRCm39) missense probably damaging 0.99
R2518:Rad51ap2 UTSW 12 11,507,068 (GRCm39) missense probably damaging 0.99
R2929:Rad51ap2 UTSW 12 11,507,185 (GRCm39) missense probably benign 0.07
R3085:Rad51ap2 UTSW 12 11,506,758 (GRCm39) missense possibly damaging 0.53
R4009:Rad51ap2 UTSW 12 11,507,052 (GRCm39) missense probably benign 0.33
R4108:Rad51ap2 UTSW 12 11,508,396 (GRCm39) missense probably damaging 1.00
R4282:Rad51ap2 UTSW 12 11,506,465 (GRCm39) missense probably benign 0.01
R4536:Rad51ap2 UTSW 12 11,507,850 (GRCm39) missense possibly damaging 0.90
R4594:Rad51ap2 UTSW 12 11,507,881 (GRCm39) missense probably benign 0.01
R4678:Rad51ap2 UTSW 12 11,506,552 (GRCm39) missense probably damaging 0.96
R4810:Rad51ap2 UTSW 12 11,507,406 (GRCm39) missense probably damaging 1.00
R5151:Rad51ap2 UTSW 12 11,507,516 (GRCm39) missense probably benign 0.09
R5421:Rad51ap2 UTSW 12 11,509,368 (GRCm39) nonsense probably null
R5517:Rad51ap2 UTSW 12 11,508,313 (GRCm39) missense probably benign 0.19
R5786:Rad51ap2 UTSW 12 11,506,921 (GRCm39) missense probably damaging 1.00
R5884:Rad51ap2 UTSW 12 11,507,534 (GRCm39) small deletion probably benign
R5932:Rad51ap2 UTSW 12 11,508,387 (GRCm39) missense probably damaging 1.00
R6022:Rad51ap2 UTSW 12 11,508,523 (GRCm39) missense probably damaging 1.00
R6064:Rad51ap2 UTSW 12 11,507,418 (GRCm39) missense possibly damaging 0.80
R6112:Rad51ap2 UTSW 12 11,507,290 (GRCm39) missense probably benign 0.01
R6235:Rad51ap2 UTSW 12 11,507,517 (GRCm39) missense possibly damaging 0.70
R6282:Rad51ap2 UTSW 12 11,507,560 (GRCm39) missense probably benign 0.12
R6488:Rad51ap2 UTSW 12 11,508,161 (GRCm39) missense possibly damaging 0.56
R6668:Rad51ap2 UTSW 12 11,507,647 (GRCm39) missense probably benign 0.17
R6759:Rad51ap2 UTSW 12 11,507,145 (GRCm39) missense possibly damaging 0.91
R7030:Rad51ap2 UTSW 12 11,507,432 (GRCm39) missense possibly damaging 0.93
R7080:Rad51ap2 UTSW 12 11,506,366 (GRCm39) missense probably benign
R7105:Rad51ap2 UTSW 12 11,508,278 (GRCm39) missense possibly damaging 0.84
R7269:Rad51ap2 UTSW 12 11,506,807 (GRCm39) missense possibly damaging 0.67
R7286:Rad51ap2 UTSW 12 11,507,692 (GRCm39) missense probably benign 0.19
R7305:Rad51ap2 UTSW 12 11,507,344 (GRCm39) missense possibly damaging 0.68
R7451:Rad51ap2 UTSW 12 11,507,982 (GRCm39) missense probably benign 0.05
R7632:Rad51ap2 UTSW 12 11,507,116 (GRCm39) missense possibly damaging 0.85
R7833:Rad51ap2 UTSW 12 11,506,656 (GRCm39) missense probably benign
R7839:Rad51ap2 UTSW 12 11,507,238 (GRCm39) missense possibly damaging 0.83
R7953:Rad51ap2 UTSW 12 11,512,593 (GRCm39) nonsense probably null
R8040:Rad51ap2 UTSW 12 11,508,792 (GRCm39) missense probably benign 0.03
R8879:Rad51ap2 UTSW 12 11,507,401 (GRCm39) missense possibly damaging 0.55
R8963:Rad51ap2 UTSW 12 11,506,255 (GRCm39) missense possibly damaging 0.91
R9010:Rad51ap2 UTSW 12 11,508,675 (GRCm39) missense probably benign 0.01
R9328:Rad51ap2 UTSW 12 11,507,772 (GRCm39) missense probably benign 0.03
R9691:Rad51ap2 UTSW 12 11,509,413 (GRCm39) missense possibly damaging 0.70
R9712:Rad51ap2 UTSW 12 11,507,593 (GRCm39) missense possibly damaging 0.95
RF023:Rad51ap2 UTSW 12 11,508,076 (GRCm39) missense possibly damaging 0.94
X0026:Rad51ap2 UTSW 12 11,508,097 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGAACATTCCAGGCGCACAG -3'
(R):5'- CTAGGTTTGGCACTTTCCAAG -3'

Sequencing Primer
(F):5'- CACAGCTGTTGGCAGTCTG -3'
(R):5'- TTGGCACTTTCCAAGCAGGC -3'
Posted On 2015-10-08