Incidental Mutation 'R4679:Ap5m1'
ID349949
Institutional Source Beutler Lab
Gene Symbol Ap5m1
Ensembl Gene ENSMUSG00000036291
Gene Nameadaptor-related protein complex 5, mu 1 subunit
SynonymsMudeng, 4932432K03Rik
MMRRC Submission 041932-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4679 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location49066097-49094234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49078828 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 285 (I285T)
Ref Sequence ENSEMBL: ENSMUSP00000153761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037473] [ENSMUST00000227410] [ENSMUST00000227431] [ENSMUST00000227608] [ENSMUST00000228238]
Predicted Effect probably benign
Transcript: ENSMUST00000037473
AA Change: I285T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000046536
Gene: ENSMUSG00000036291
AA Change: I285T

DomainStartEndE-ValueType
low complexity region 51 68 N/A INTRINSIC
Pfam:Adap_comp_sub 196 476 3.2e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227066
Predicted Effect probably benign
Transcript: ENSMUST00000227410
Predicted Effect probably benign
Transcript: ENSMUST00000227431
AA Change: I285T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000227608
Predicted Effect probably benign
Transcript: ENSMUST00000227991
Predicted Effect probably benign
Transcript: ENSMUST00000228238
Meta Mutation Damage Score 0.0776 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 98% (112/114)
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik C T 4: 35,226,033 probably benign Het
AA986860 T A 1: 130,742,403 S121T possibly damaging Het
Abcb9 A G 5: 124,078,804 V450A probably benign Het
Abcg1 A T 17: 31,114,261 R659S probably benign Het
Acad9 A T 3: 36,088,840 N508I possibly damaging Het
Acrbp T A 6: 125,060,918 C393S probably damaging Het
Adcy7 T C 8: 88,317,937 V486A probably benign Het
Adgrf1 G T 17: 43,310,493 L540F probably damaging Het
Arhgap27 G T 11: 103,360,949 probably benign Het
Armc5 A T 7: 128,240,104 E198V possibly damaging Het
Atp8b5 A T 4: 43,365,955 K742M probably benign Het
Atp9a T G 2: 168,661,964 T603P possibly damaging Het
Bsn A G 9: 108,110,130 S2808P unknown Het
Catsper4 T C 4: 134,226,605 N81S probably damaging Het
Ccl17 C G 8: 94,810,500 T10S probably benign Het
Cdc123 A T 2: 5,844,892 V6D probably damaging Het
Cdca2 T C 14: 67,714,966 K14E possibly damaging Het
Cdh3 C A 8: 106,539,856 T302K probably damaging Het
Cdh9 A G 15: 16,850,959 M605V probably benign Het
Cdk4 A G 10: 127,064,911 E144G possibly damaging Het
Clasp1 C T 1: 118,543,271 A879V probably damaging Het
Cldn8 G A 16: 88,562,408 H210Y probably benign Het
Cntn5 T C 9: 9,970,531 D518G probably benign Het
Cog1 C T 11: 113,652,290 A208V probably damaging Het
Col4a2 T A 8: 11,431,337 H836Q possibly damaging Het
Copb1 T C 7: 114,248,976 D108G probably damaging Het
Csmd3 A T 15: 48,161,083 Y600* probably null Het
Cyb5r1 T A 1: 134,407,833 H164Q probably benign Het
Dkc1 A G X: 75,100,992 I215V probably benign Het
Enpep A G 3: 129,303,713 probably null Het
Fam71b T A 11: 46,404,813 M4K possibly damaging Het
Fbln7 A G 2: 128,894,886 Y311C probably damaging Het
Fign A C 2: 63,979,261 L555R probably damaging Het
Fkbp7 A T 2: 76,671,688 probably benign Het
Fmn2 T C 1: 174,503,162 S373P unknown Het
Frmd4b C T 6: 97,295,666 D868N possibly damaging Het
Gfpt2 A G 11: 49,823,737 N321S probably benign Het
Glmn G T 5: 107,561,075 T372K probably damaging Het
Gm26602 C T 10: 79,910,974 probably benign Het
Gm6797 A G X: 8,639,694 noncoding transcript Het
Gpat3 T A 5: 100,893,456 F383L probably damaging Het
Grrp1 A G 4: 134,251,436 S244P probably damaging Het
H2-M11 C T 17: 36,548,150 T194I possibly damaging Het
Hcn1 C T 13: 117,657,015 H268Y probably benign Het
Hectd4 G T 5: 121,325,251 C2345F possibly damaging Het
Htt A G 5: 34,820,080 D770G probably benign Het
Ints3 T C 3: 90,408,510 T316A possibly damaging Het
Ipo9 A G 1: 135,394,169 F608L probably benign Het
Irak1 A C X: 74,022,389 probably benign Het
Jam2 G A 16: 84,812,952 V151M probably damaging Het
Lag3 T A 6: 124,904,545 Q488L possibly damaging Het
Large2 A T 2: 92,367,558 L266Q probably benign Het
Lrp3 T G 7: 35,203,940 D327A probably damaging Het
Mamstr C A 7: 45,644,692 probably benign Het
Mettl14 G A 3: 123,369,414 probably benign Het
Miga1 A G 3: 152,322,475 V139A probably damaging Het
Mthfd2l A C 5: 90,948,911 R130S probably benign Het
Myo1b A G 1: 51,757,973 I970T possibly damaging Het
Nat10 C A 2: 103,732,170 W607L probably damaging Het
Nop56 A G 2: 130,278,273 T183A probably benign Het
Olfr1258 A G 2: 89,930,664 Y285C possibly damaging Het
Olfr239 A G 17: 33,199,393 H115R probably benign Het
Olfr291 T A 7: 84,856,904 Y178* probably null Het
Olfr464 T A 11: 87,914,310 M199L probably benign Het
Olfr592 A G 7: 103,187,102 Y167C probably benign Het
Olfr710 A T 7: 106,944,945 S19T probably benign Het
Pcdhb12 T C 18: 37,436,949 F383L probably damaging Het
Pde4dip C A 3: 97,695,005 D2252Y probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Plscr2 T G 9: 92,287,770 L91R probably benign Het
Plxnc1 T A 10: 94,794,444 Y1531F probably damaging Het
Ptprq A T 10: 107,685,182 F710I probably benign Het
Rad51ap2 A G 12: 11,456,551 E158G probably damaging Het
Rasip1 T A 7: 45,627,823 H18Q possibly damaging Het
Rcsd1 T A 1: 165,655,924 N166I probably damaging Het
Ripor1 T A 8: 105,617,785 I517K possibly damaging Het
Ryr2 T A 13: 11,824,369 H506L probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sept14 T C 5: 129,693,026 D202G possibly damaging Het
Siglec1 A T 2: 131,073,411 L1420Q possibly damaging Het
Slc22a29 T A 19: 8,161,584 I505F possibly damaging Het
Sorcs1 T A 19: 50,182,669 Y927F probably benign Het
Spats2 T G 15: 99,180,722 M191R possibly damaging Het
Sycp1 C T 3: 102,922,462 probably null Het
T2 A G 17: 8,391,016 E99G possibly damaging Het
Taf3 G A 2: 10,048,564 probably benign Het
Tnfsf10 A T 3: 27,335,579 N263I probably damaging Het
Treml2 A T 17: 48,308,175 R229S probably benign Het
Trmt13 T C 3: 116,589,755 K125E probably damaging Het
Ttc9 G T 12: 81,631,601 C66F probably damaging Het
Vmn2r63 C T 7: 42,928,120 M331I probably benign Het
Zfp353-ps T C 8: 42,082,214 noncoding transcript Het
Zfp932 A T 5: 110,009,894 H486L probably damaging Het
Other mutations in Ap5m1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Ap5m1 APN 14 49073790 missense probably damaging 1.00
IGL01806:Ap5m1 APN 14 49080340 missense probably damaging 1.00
IGL02011:Ap5m1 APN 14 49081135 unclassified probably benign
IGL02165:Ap5m1 APN 14 49078728 missense possibly damaging 0.94
IGL02203:Ap5m1 APN 14 49080258 missense probably damaging 1.00
IGL02950:Ap5m1 APN 14 49073935 missense probably benign 0.44
IGL03123:Ap5m1 APN 14 49073761 missense probably damaging 1.00
IGL03368:Ap5m1 APN 14 49081136 unclassified probably benign
R1688:Ap5m1 UTSW 14 49080834 critical splice acceptor site probably null
R2113:Ap5m1 UTSW 14 49086248 missense probably damaging 1.00
R2184:Ap5m1 UTSW 14 49086295 missense probably damaging 1.00
R2220:Ap5m1 UTSW 14 49081095 missense probably damaging 1.00
R2971:Ap5m1 UTSW 14 49083882 nonsense probably null
R3425:Ap5m1 UTSW 14 49073683 missense probably damaging 0.99
R4506:Ap5m1 UTSW 14 49073761 missense probably damaging 1.00
R4799:Ap5m1 UTSW 14 49081070 missense probably benign 0.08
R6365:Ap5m1 UTSW 14 49078828 missense probably benign 0.00
R6834:Ap5m1 UTSW 14 49073737 missense probably damaging 0.99
R7115:Ap5m1 UTSW 14 49086270 nonsense probably null
R7224:Ap5m1 UTSW 14 49080927 missense unknown
R7383:Ap5m1 UTSW 14 49074196 missense possibly damaging 0.77
R7539:Ap5m1 UTSW 14 49073557 missense probably damaging 1.00
R7866:Ap5m1 UTSW 14 49073761 missense probably damaging 1.00
R7897:Ap5m1 UTSW 14 49073775 missense probably benign 0.11
R7949:Ap5m1 UTSW 14 49073761 missense probably damaging 1.00
R7980:Ap5m1 UTSW 14 49073775 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TTGCTTTTAAGGTCTTGGTCAACC -3'
(R):5'- ATTACAGGCATCAGAGATAAGAGCC -3'

Sequencing Primer
(F):5'- AAGGTCTTGGTCAACCTTGTTC -3'
(R):5'- CAGGCATCAGAGATAAGAGCCTATTC -3'
Posted On2015-10-08