Incidental Mutation 'R0267:D6Wsu163e'
ID34995
Institutional Source Beutler Lab
Gene Symbol D6Wsu163e
Ensembl Gene ENSMUSG00000030347
Gene NameDNA segment, Chr 6, Wayne State University 163, expressed
Synonyms
MMRRC Submission 038493-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0267 (G1)
Quality Score209
Status Validated
Chromosome6
Chromosomal Location126939962-126975967 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 126946491 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 113 (H113Q)
Ref Sequence ENSEMBL: ENSMUSP00000032497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032497] [ENSMUST00000201617]
Predicted Effect probably benign
Transcript: ENSMUST00000032497
AA Change: H113Q

PolyPhen 2 Score 0.167 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000032497
Gene: ENSMUSG00000030347
AA Change: H113Q

DomainStartEndE-ValueType
Pfam:DUF2362 41 546 4.4e-218 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201113
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201603
Predicted Effect probably benign
Transcript: ENSMUST00000201617
SMART Domains Protein: ENSMUSP00000144570
Gene: ENSMUSG00000030347

DomainStartEndE-ValueType
Pfam:DUF2362 41 83 2.4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202086
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202964
Meta Mutation Damage Score 0.3760 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.7%
  • 10x: 96.2%
  • 20x: 94.0%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is highly conserved from nematodes to humans. In rat, the orthologous gene encodes a cytoplasmic protein that is involved in mast cell degranulation. The human gene has been implicated in autosomal recessive intellectual disability. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,046,105 F1721S probably damaging Het
Adgrb1 G A 15: 74,529,389 R78H probably damaging Het
Adgrd1 G A 5: 129,139,594 A342T probably benign Het
Adrb1 A T 19: 56,723,491 K374* probably null Het
Aldh18a1 C A 19: 40,573,789 V264F probably benign Het
Aldh1l2 C T 10: 83,522,687 probably benign Het
Alox15 T A 11: 70,346,153 H393L probably damaging Het
Aox2 A G 1: 58,339,446 probably benign Het
Appbp2 T C 11: 85,201,462 Y297C probably damaging Het
Atxn2l T G 7: 126,493,207 Q950P probably damaging Het
Bicd1 A T 6: 149,517,042 D737V probably damaging Het
C9 T C 15: 6,467,458 I212T probably benign Het
Ccdc63 A T 5: 122,117,044 probably benign Het
Chst1 C A 2: 92,613,606 P141Q probably damaging Het
Cped1 T A 6: 22,119,476 F311L probably damaging Het
Dcn A T 10: 97,506,483 probably benign Het
Dmbx1 C T 4: 115,918,112 A324T probably benign Het
Dock10 G T 1: 80,512,454 Q1618K probably damaging Het
Dpyd A G 3: 118,917,272 E443G probably benign Het
Espl1 T C 15: 102,313,017 V953A possibly damaging Het
Exosc10 T C 4: 148,562,756 L174P probably damaging Het
Foxg1 A G 12: 49,385,582 Y366C probably damaging Het
Fxyd3 T C 7: 31,070,734 probably benign Het
Gbp2 T C 3: 142,630,106 V189A probably benign Het
Gins4 T C 8: 23,229,410 probably benign Het
Gm12789 A G 4: 101,988,122 T3A probably benign Het
Gnb1l T C 16: 18,548,089 probably benign Het
Gtpbp3 T C 8: 71,491,497 L295S probably damaging Het
Hrh4 C A 18: 13,022,398 Y331* probably null Het
Hsd11b1 A T 1: 193,241,397 Y52N probably damaging Het
Jam3 A G 9: 27,106,405 I29T probably benign Het
Kctd16 T A 18: 40,530,877 I353N probably benign Het
Lama4 G T 10: 39,028,639 G246C probably damaging Het
Lhx3 T A 2: 26,203,028 M137L probably benign Het
Morc2a T C 11: 3,678,567 I340T probably benign Het
Myo7a A C 7: 98,054,624 I1969S probably benign Het
Olfr1471 T A 19: 13,445,428 C139S probably damaging Het
Olfr304 T C 7: 86,386,267 E131G possibly damaging Het
Olfr429 A G 1: 174,089,166 N42S probably damaging Het
Pclo T C 5: 14,681,180 L3232P unknown Het
Polr1a T G 6: 71,974,139 I1407M probably damaging Het
Ppip5k2 A G 1: 97,728,997 V817A probably damaging Het
Rbfox3 T C 11: 118,495,240 T280A probably benign Het
Rfx3 T C 19: 27,793,788 D521G probably benign Het
Scn5a C T 9: 119,543,135 V223I probably damaging Het
Sgsm3 T G 15: 81,006,602 M119R probably damaging Het
Slc6a7 T A 18: 60,996,711 M608L probably benign Het
Slit2 A G 5: 48,182,331 probably benign Het
Steap2 T A 5: 5,673,561 I440F probably benign Het
Syn2 T G 6: 115,254,150 probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tfb2m G A 1: 179,533,638 H262Y probably benign Het
Trmt1l A G 1: 151,457,675 probably benign Het
Trpm6 C A 19: 18,823,378 P819T probably benign Het
Ttn G A 2: 76,743,689 A25620V probably damaging Het
Ubn2 T C 6: 38,482,618 probably null Het
Vars T C 17: 35,011,596 probably benign Het
Vip A T 10: 5,644,004 D119V possibly damaging Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Vps33b T C 7: 80,286,054 I405T possibly damaging Het
Zbtb21 T A 16: 97,952,100 S356C probably damaging Het
Zdhhc6 A T 19: 55,308,930 S237T probably benign Het
Zfp142 G A 1: 74,576,064 A427V probably benign Het
Zfp692 T A 11: 58,314,314 V463E possibly damaging Het
Zmynd8 A T 2: 165,828,402 I384N probably damaging Het
Other mutations in D6Wsu163e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:D6Wsu163e APN 6 126944852 missense possibly damaging 0.89
IGL02019:D6Wsu163e APN 6 126955221 missense probably damaging 1.00
IGL02890:D6Wsu163e APN 6 126974487 missense probably damaging 1.00
IGL02954:D6Wsu163e APN 6 126974478 splice site probably benign
IGL03179:D6Wsu163e APN 6 126950111 missense probably damaging 1.00
R1405:D6Wsu163e UTSW 6 126974483 splice site probably benign
R1483:D6Wsu163e UTSW 6 126954770 missense probably benign 0.03
R1636:D6Wsu163e UTSW 6 126946601 missense possibly damaging 0.54
R1847:D6Wsu163e UTSW 6 126955149 missense probably damaging 1.00
R5883:D6Wsu163e UTSW 6 126966916 missense probably damaging 1.00
R7402:D6Wsu163e UTSW 6 126962005 missense probably damaging 0.98
R7587:D6Wsu163e UTSW 6 126955896 missense probably benign 0.00
R8229:D6Wsu163e UTSW 6 126967003 missense probably benign 0.12
R8347:D6Wsu163e UTSW 6 126955288 nonsense probably null
R8732:D6Wsu163e UTSW 6 126955896 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TGTCCCTTGCTCTGTAGGAGTACC -3'
(R):5'- AGATACTGTGGCTTAGAGGAAGCCC -3'

Sequencing Primer
(F):5'- GCTCTGTAGGAGTACCTCATTC -3'
(R):5'- ggggcttaaagatcaaagaagac -3'
Posted On2013-05-09