Mutagenetix > Incidental Mutations

Incidental Mutation 'R0267:Bicd1'

34996

Institutional Source

Beutler Lab

Gene Symbol

Bicd1

Ensembl Gene

ENSMUSG00000003452

Gene Name

BICD cargo adaptor 1

Synonyms

B830009D06Rik

MMRRC Submission

038493-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0267 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

149408886-149563329 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 149517042 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 737 (D737V)

Ref Sequence

ENSEMBL: ENSMUSP00000133727 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003544] [ENSMUST00000086829] [ENSMUST00000111513] [ENSMUST00000172926] [ENSMUST00000173408]

Predicted Effect

probably damaging
Transcript: ENSMUST00000003544
AA Change: D737V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000003544
Gene: ENSMUSG00000003452
AA Change: D737V

Domain	Start	End	E-Value	Type
low complexity region	14	32	N/A	INTRINSIC
Pfam:BicD	74	799	N/A	PFAM
low complexity region	807	820	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000086829
AA Change: D737V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000084039
Gene: ENSMUSG00000003452
AA Change: D737V

Domain	Start	End	E-Value	Type
low complexity region	14	32	N/A	INTRINSIC
Pfam:BicD	74	799	N/A	PFAM
low complexity region	807	820	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000111513
AA Change: D737V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000107138
Gene: ENSMUSG00000003452
AA Change: D737V

Domain	Start	End	E-Value	Type
low complexity region	14	32	N/A	INTRINSIC
Pfam:BicD	74	799	N/A	PFAM
low complexity region	807	822	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000172926
AA Change: D36V

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000133986
Gene: ENSMUSG00000003452
AA Change: D36V

Domain	Start	End	E-Value	Type
Pfam:BicD	1	98	1.2e-69	PFAM
low complexity region	103	120	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000173408
AA Change: D737V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000133727
Gene: ENSMUSG00000003452
AA Change: D737V

Domain	Start	End	E-Value	Type
low complexity region	14	32	N/A	INTRINSIC
Pfam:BicD	74	799	N/A	PFAM
low complexity region	807	820	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174886

Coding Region Coverage

1x: 98.6%
3x: 97.7%
10x: 96.2%
20x: 94.0%

Validation Efficiency

97% (64/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of two human homologs of Drosophila bicaudal-D. It has been implicated in COPI-independent membrane transport from the Golgi apparatus to the endoplasmic reticulum. Two alternative splice variants have been described. Other alternative splice variants that encode different protein isoforms have been described but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	A	G	4: 53,046,105	F1721S	probably damaging	Het
Adgrb1	G	A	15: 74,529,389	R78H	probably damaging	Het
Adgrd1	G	A	5: 129,139,594	A342T	probably benign	Het
Adrb1	A	T	19: 56,723,491	K374*	probably null	Het
Aldh18a1	C	A	19: 40,573,789	V264F	probably benign	Het
Aldh1l2	C	T	10: 83,522,687		probably benign	Het
Alox15	T	A	11: 70,346,153	H393L	probably damaging	Het
Aox2	A	G	1: 58,339,446		probably benign	Het
Appbp2	T	C	11: 85,201,462	Y297C	probably damaging	Het
Atxn2l	T	G	7: 126,493,207	Q950P	probably damaging	Het
C9	T	C	15: 6,467,458	I212T	probably benign	Het
Ccdc63	A	T	5: 122,117,044		probably benign	Het
Chst1	C	A	2: 92,613,606	P141Q	probably damaging	Het
Cped1	T	A	6: 22,119,476	F311L	probably damaging	Het
D6Wsu163e	T	A	6: 126,946,491	H113Q	probably benign	Het
Dcn	A	T	10: 97,506,483		probably benign	Het
Dmbx1	C	T	4: 115,918,112	A324T	probably benign	Het
Dock10	G	T	1: 80,512,454	Q1618K	probably damaging	Het
Dpyd	A	G	3: 118,917,272	E443G	probably benign	Het
Espl1	T	C	15: 102,313,017	V953A	possibly damaging	Het
Exosc10	T	C	4: 148,562,756	L174P	probably damaging	Het
Foxg1	A	G	12: 49,385,582	Y366C	probably damaging	Het
Fxyd3	T	C	7: 31,070,734		probably benign	Het
Gbp2	T	C	3: 142,630,106	V189A	probably benign	Het
Gins4	T	C	8: 23,229,410		probably benign	Het
Gm12789	A	G	4: 101,988,122	T3A	probably benign	Het
Gnb1l	T	C	16: 18,548,089		probably benign	Het
Gtpbp3	T	C	8: 71,491,497	L295S	probably damaging	Het
Hrh4	C	A	18: 13,022,398	Y331*	probably null	Het
Hsd11b1	A	T	1: 193,241,397	Y52N	probably damaging	Het
Jam3	A	G	9: 27,106,405	I29T	probably benign	Het
Kctd16	T	A	18: 40,530,877	I353N	probably benign	Het
Lama4	G	T	10: 39,028,639	G246C	probably damaging	Het
Lhx3	T	A	2: 26,203,028	M137L	probably benign	Het
Morc2a	T	C	11: 3,678,567	I340T	probably benign	Het
Myo7a	A	C	7: 98,054,624	I1969S	probably benign	Het
Olfr1471	T	A	19: 13,445,428	C139S	probably damaging	Het
Olfr304	T	C	7: 86,386,267	E131G	possibly damaging	Het
Olfr429	A	G	1: 174,089,166	N42S	probably damaging	Het
Pclo	T	C	5: 14,681,180	L3232P	unknown	Het
Polr1a	T	G	6: 71,974,139	I1407M	probably damaging	Het
Ppip5k2	A	G	1: 97,728,997	V817A	probably damaging	Het
Rbfox3	T	C	11: 118,495,240	T280A	probably benign	Het
Rfx3	T	C	19: 27,793,788	D521G	probably benign	Het
Scn5a	C	T	9: 119,543,135	V223I	probably damaging	Het
Sgsm3	T	G	15: 81,006,602	M119R	probably damaging	Het
Slc6a7	T	A	18: 60,996,711	M608L	probably benign	Het
Slit2	A	G	5: 48,182,331		probably benign	Het
Steap2	T	A	5: 5,673,561	I440F	probably benign	Het
Syn2	T	G	6: 115,254,150		probably benign	Het
Taar2	G	A	10: 23,941,495	R311H	probably benign	Het
Tfb2m	G	A	1: 179,533,638	H262Y	probably benign	Het
Trmt1l	A	G	1: 151,457,675		probably benign	Het
Trpm6	C	A	19: 18,823,378	P819T	probably benign	Het
Ttn	G	A	2: 76,743,689	A25620V	probably damaging	Het
Ubn2	T	C	6: 38,482,618		probably null	Het
Vars	T	C	17: 35,011,596		probably benign	Het
Vip	A	T	10: 5,644,004	D119V	possibly damaging	Het
Vmn2r92	C	T	17: 18,167,957	A408V	probably damaging	Het
Vps33b	T	C	7: 80,286,054	I405T	possibly damaging	Het
Zbtb21	T	A	16: 97,952,100	S356C	probably damaging	Het
Zdhhc6	A	T	19: 55,308,930	S237T	probably benign	Het
Zfp142	G	A	1: 74,576,064	A427V	probably benign	Het
Zfp692	T	A	11: 58,314,314	V463E	possibly damaging	Het
Zmynd8	A	T	2: 165,828,402	I384N	probably damaging	Het

Other mutations in Bicd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00163:Bicd1	APN	6	149550390	missense	possibly damaging	0.72
IGL02489:Bicd1	APN	6	149513037	missense	probably damaging	1.00
IGL02626:Bicd1	APN	6	149409556	missense	probably damaging	1.00
IGL02966:Bicd1	APN	6	149483996	missense	probably damaging	0.99
IGL03256:Bicd1	APN	6	149513585	missense	probably benign
R0123:Bicd1	UTSW	6	149512950	missense	probably benign	0.00
R0131:Bicd1	UTSW	6	149512947	missense	probably damaging	0.99
R0134:Bicd1	UTSW	6	149512950	missense	probably benign	0.00
R0225:Bicd1	UTSW	6	149512950	missense	probably benign	0.00
R0481:Bicd1	UTSW	6	149511891	missense	possibly damaging	0.90
R0560:Bicd1	UTSW	6	149511962	missense	probably benign	0.34
R0729:Bicd1	UTSW	6	149512914	missense	probably damaging	0.97
R0784:Bicd1	UTSW	6	149513363	missense	probably damaging	0.98
R1994:Bicd1	UTSW	6	149513552	missense	probably benign	0.00
R2221:Bicd1	UTSW	6	149517005	missense	probably damaging	0.98
R2762:Bicd1	UTSW	6	149520403	missense	probably damaging	0.99
R3428:Bicd1	UTSW	6	149512902	missense	probably damaging	1.00
R3805:Bicd1	UTSW	6	149518991	missense	probably damaging	1.00
R3806:Bicd1	UTSW	6	149518991	missense	probably damaging	1.00
R3807:Bicd1	UTSW	6	149518991	missense	probably damaging	1.00
R4694:Bicd1	UTSW	6	149409553	missense	probably damaging	1.00
R4822:Bicd1	UTSW	6	149519254	intron	probably benign
R4835:Bicd1	UTSW	6	149484090	missense	probably benign	0.00
R5157:Bicd1	UTSW	6	149520414	missense	probably benign	0.09
R5527:Bicd1	UTSW	6	149494636	missense	probably damaging	1.00
R5611:Bicd1	UTSW	6	149513456	nonsense	probably null
R5643:Bicd1	UTSW	6	149520403	missense	probably damaging	0.99
R5644:Bicd1	UTSW	6	149520403	missense	probably damaging	0.99
R5788:Bicd1	UTSW	6	149484000	missense	probably benign	0.39
R5898:Bicd1	UTSW	6	149513703	missense	probably damaging	0.99
R6222:Bicd1	UTSW	6	149512965	missense	probably damaging	1.00
R6227:Bicd1	UTSW	6	149513176	nonsense	probably null
R6522:Bicd1	UTSW	6	149484005	missense	probably benign
R6781:Bicd1	UTSW	6	149513166	missense	possibly damaging	0.86
R6812:Bicd1	UTSW	6	149409537	missense	probably damaging	1.00
R7010:Bicd1	UTSW	6	149494615	missense	probably damaging	1.00
R7203:Bicd1	UTSW	6	149512905	missense	possibly damaging	0.91
R7265:Bicd1	UTSW	6	149513876	missense	probably damaging	1.00
R7362:Bicd1	UTSW	6	149484093	missense	probably benign	0.13
R7526:Bicd1	UTSW	6	149513726	missense	possibly damaging	0.46
R7545:Bicd1	UTSW	6	149513492	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACTACTGCCACCACACTGAATTCTG -3'
(R):5'- TGCAGCCTTGCAGTCTAAGGTTTC -3'

Sequencing Primer
(F):5'- CTGATACTTACTGACTCATACCAGG -3'
(R):5'- GTCATCTCCATGAGATTCAGTTGC -3'

Posted On

2013-05-09