Incidental Mutation 'R4680:Olfr1099'
ID349973
Institutional Source Beutler Lab
Gene Symbol Olfr1099
Ensembl Gene ENSMUSG00000075168
Gene Nameolfactory receptor 1099
SynonymsMOR206-3, GA_x6K02T2Q125-48446067-48445129
MMRRC Submission 041933-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R4680 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86955126-86960693 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86959321 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 46 (I46V)
Ref Sequence ENSEMBL: ENSMUSP00000149528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099871] [ENSMUST00000213456]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099871
AA Change: I46V

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097456
Gene: ENSMUSG00000075168
AA Change: I46V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.9e-54 PFAM
Pfam:7tm_1 41 290 1.2e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213456
AA Change: I46V

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.3688 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A T 2: 151,473,470 L96Q probably damaging Het
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
4931414P19Rik T C 14: 54,585,076 Y368C probably damaging Het
Acin1 T C 14: 54,686,758 N8S probably benign Het
Aspm T C 1: 139,480,671 V2432A probably benign Het
Atf2 A T 2: 73,828,681 probably null Het
B3gnt2 A G 11: 22,837,105 S28P probably damaging Het
Chil5 A G 3: 106,034,875 probably benign Het
Crybg2 CTTCCAGAGCCATGGACCCATCTTTTCCA CTTCCA 4: 134,072,718 probably null Het
Dennd3 A T 15: 73,533,376 H326L possibly damaging Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
Eprs T C 1: 185,386,278 V461A possibly damaging Het
Fhad1 G A 4: 142,011,547 Q31* probably null Het
Gpr26 A G 7: 131,974,353 T249A probably benign Het
Gtf2ird1 T A 5: 134,357,881 M958L probably damaging Het
Kat2b-ps A G 5: 93,391,440 noncoding transcript Het
Kdm2b A T 5: 122,934,786 V343E probably damaging Het
Lipi A G 16: 75,565,529 probably null Het
Ltb4r1 T C 14: 55,767,468 F76S probably damaging Het
Msantd2 A G 9: 37,523,091 Y209C probably damaging Het
Nid1 G A 13: 13,472,852 C401Y probably damaging Het
Obox1 A T 7: 15,556,164 N144I probably damaging Het
Olfr1051 T A 2: 86,276,173 I105F possibly damaging Het
Olfr128 T C 17: 37,923,922 S119P probably damaging Het
Plec T C 15: 76,180,575 E1630G unknown Het
Ppp2r5e C T 12: 75,469,759 R218Q probably damaging Het
Prkdc A G 16: 15,772,030 T2586A probably benign Het
Ptprj T C 2: 90,460,496 N633S probably benign Het
Rab11fip2 T C 19: 59,936,020 N284S probably benign Het
Ropn1 A G 16: 34,677,305 Q189R possibly damaging Het
Rwdd2b A G 16: 87,437,062 probably null Het
Ryr2 A T 13: 11,595,233 S4236T probably benign Het
Sigmar1 A G 4: 41,741,251 M1T probably null Het
Sncg T A 14: 34,373,311 N79I probably benign Het
Traf3ip2 C T 10: 39,639,260 P345S possibly damaging Het
Ttn C T 2: 76,932,677 G3213S probably damaging Het
Uqcrc1 G A 9: 108,947,861 R77H probably damaging Het
Vps13d A C 4: 145,108,510 L2756R possibly damaging Het
Other mutations in Olfr1099
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01110:Olfr1099 APN 2 86958921 missense possibly damaging 0.90
IGL01624:Olfr1099 APN 2 86959230 missense probably benign 0.05
IGL02119:Olfr1099 APN 2 86959183 missense probably benign 0.24
IGL02433:Olfr1099 APN 2 86959048 missense possibly damaging 0.63
IGL02646:Olfr1099 APN 2 86959353 missense probably damaging 1.00
IGL02824:Olfr1099 APN 2 86958993 missense probably benign 0.03
IGL03228:Olfr1099 APN 2 86958706 missense probably benign 0.16
R0208:Olfr1099 UTSW 2 86959404 missense probably damaging 0.96
R0521:Olfr1099 UTSW 2 86958846 missense probably damaging 1.00
R0783:Olfr1099 UTSW 2 86958562 missense probably benign
R1706:Olfr1099 UTSW 2 86959080 missense probably damaging 1.00
R1859:Olfr1099 UTSW 2 86959081 missense probably damaging 0.99
R2046:Olfr1099 UTSW 2 86958733 missense possibly damaging 0.75
R2126:Olfr1099 UTSW 2 86959098 missense possibly damaging 0.63
R2140:Olfr1099 UTSW 2 86959281 missense probably damaging 1.00
R4452:Olfr1099 UTSW 2 86958699 missense probably damaging 0.99
R4958:Olfr1099 UTSW 2 86959105 missense possibly damaging 0.75
R4970:Olfr1099 UTSW 2 86959354 missense probably damaging 1.00
R5112:Olfr1099 UTSW 2 86959354 missense probably damaging 1.00
R5532:Olfr1099 UTSW 2 86958580 nonsense probably null
R5691:Olfr1099 UTSW 2 86959272 missense probably damaging 1.00
R6851:Olfr1099 UTSW 2 86959267 missense possibly damaging 0.46
R6858:Olfr1099 UTSW 2 86958690 missense probably benign 0.11
R7368:Olfr1099 UTSW 2 86959258 missense probably damaging 1.00
Z1088:Olfr1099 UTSW 2 86958666 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATTTGAGTGAAGCAGCCCA -3'
(R):5'- AGGAGCCAATGATACTTCTGTAA -3'

Sequencing Primer
(F):5'- TGAAGCAGCCCATGAAAGAAATATTC -3'
(R):5'- TTGTACCTTGTTTCTCTTTGAAAATG -3'
Posted On2015-10-08