Incidental Mutation 'R0267:Vps33b'
ID34998
Institutional Source Beutler Lab
Gene Symbol Vps33b
Ensembl Gene ENSMUSG00000030534
Gene Namevacuolar protein sorting 33B
Synonyms
MMRRC Submission 038493-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0267 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location80269649-80291754 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80286054 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 405 (I405T)
Ref Sequence ENSEMBL: ENSMUSP00000032749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032749] [ENSMUST00000135053] [ENSMUST00000150585]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032749
AA Change: I405T

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032749
Gene: ENSMUSG00000030534
AA Change: I405T

DomainStartEndE-ValueType
Pfam:Sec1 37 611 2.4e-89 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128254
Predicted Effect probably benign
Transcript: ENSMUST00000135053
SMART Domains Protein: ENSMUSP00000138472
Gene: ENSMUSG00000030534

DomainStartEndE-ValueType
SCOP:d1epua_ 18 59 2e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145594
Predicted Effect probably benign
Transcript: ENSMUST00000150585
SMART Domains Protein: ENSMUSP00000138224
Gene: ENSMUSG00000030534

DomainStartEndE-ValueType
Pfam:Sec1 36 140 1.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205864
Meta Mutation Damage Score 0.1790 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.7%
  • 10x: 96.2%
  • 20x: 94.0%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene is a member of the Sec-1 domain family, and encodes the human ortholog of rat Vps33b which is homologous to the yeast class C Vps33 protein. The mammalian class C vacuolar protein sorting proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. Mutations in this gene are associated with arthrogryposis-renal dysfunction-cholestasis syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a conditional allele activated by an inducible cre exhibit dry scaly skin, hair loss, thrombocytosis, abnormal alpha-granule development, extramedullary hematopoiesis, abnormal platelets and megakaryocytes, and defects in tail tendon collagen I structure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,046,105 F1721S probably damaging Het
Adgrb1 G A 15: 74,529,389 R78H probably damaging Het
Adgrd1 G A 5: 129,139,594 A342T probably benign Het
Adrb1 A T 19: 56,723,491 K374* probably null Het
Aldh18a1 C A 19: 40,573,789 V264F probably benign Het
Aldh1l2 C T 10: 83,522,687 probably benign Het
Alox15 T A 11: 70,346,153 H393L probably damaging Het
Aox2 A G 1: 58,339,446 probably benign Het
Appbp2 T C 11: 85,201,462 Y297C probably damaging Het
Atxn2l T G 7: 126,493,207 Q950P probably damaging Het
Bicd1 A T 6: 149,517,042 D737V probably damaging Het
C9 T C 15: 6,467,458 I212T probably benign Het
Ccdc63 A T 5: 122,117,044 probably benign Het
Chst1 C A 2: 92,613,606 P141Q probably damaging Het
Cped1 T A 6: 22,119,476 F311L probably damaging Het
D6Wsu163e T A 6: 126,946,491 H113Q probably benign Het
Dcn A T 10: 97,506,483 probably benign Het
Dmbx1 C T 4: 115,918,112 A324T probably benign Het
Dock10 G T 1: 80,512,454 Q1618K probably damaging Het
Dpyd A G 3: 118,917,272 E443G probably benign Het
Espl1 T C 15: 102,313,017 V953A possibly damaging Het
Exosc10 T C 4: 148,562,756 L174P probably damaging Het
Foxg1 A G 12: 49,385,582 Y366C probably damaging Het
Fxyd3 T C 7: 31,070,734 probably benign Het
Gbp2 T C 3: 142,630,106 V189A probably benign Het
Gins4 T C 8: 23,229,410 probably benign Het
Gm12789 A G 4: 101,988,122 T3A probably benign Het
Gnb1l T C 16: 18,548,089 probably benign Het
Gtpbp3 T C 8: 71,491,497 L295S probably damaging Het
Hrh4 C A 18: 13,022,398 Y331* probably null Het
Hsd11b1 A T 1: 193,241,397 Y52N probably damaging Het
Jam3 A G 9: 27,106,405 I29T probably benign Het
Kctd16 T A 18: 40,530,877 I353N probably benign Het
Lama4 G T 10: 39,028,639 G246C probably damaging Het
Lhx3 T A 2: 26,203,028 M137L probably benign Het
Morc2a T C 11: 3,678,567 I340T probably benign Het
Myo7a A C 7: 98,054,624 I1969S probably benign Het
Olfr1471 T A 19: 13,445,428 C139S probably damaging Het
Olfr304 T C 7: 86,386,267 E131G possibly damaging Het
Olfr429 A G 1: 174,089,166 N42S probably damaging Het
Pclo T C 5: 14,681,180 L3232P unknown Het
Polr1a T G 6: 71,974,139 I1407M probably damaging Het
Ppip5k2 A G 1: 97,728,997 V817A probably damaging Het
Rbfox3 T C 11: 118,495,240 T280A probably benign Het
Rfx3 T C 19: 27,793,788 D521G probably benign Het
Scn5a C T 9: 119,543,135 V223I probably damaging Het
Sgsm3 T G 15: 81,006,602 M119R probably damaging Het
Slc6a7 T A 18: 60,996,711 M608L probably benign Het
Slit2 A G 5: 48,182,331 probably benign Het
Steap2 T A 5: 5,673,561 I440F probably benign Het
Syn2 T G 6: 115,254,150 probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tfb2m G A 1: 179,533,638 H262Y probably benign Het
Trmt1l A G 1: 151,457,675 probably benign Het
Trpm6 C A 19: 18,823,378 P819T probably benign Het
Ttn G A 2: 76,743,689 A25620V probably damaging Het
Ubn2 T C 6: 38,482,618 probably null Het
Vars T C 17: 35,011,596 probably benign Het
Vip A T 10: 5,644,004 D119V possibly damaging Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Zbtb21 T A 16: 97,952,100 S356C probably damaging Het
Zdhhc6 A T 19: 55,308,930 S237T probably benign Het
Zfp142 G A 1: 74,576,064 A427V probably benign Het
Zfp692 T A 11: 58,314,314 V463E possibly damaging Het
Zmynd8 A T 2: 165,828,402 I384N probably damaging Het
Other mutations in Vps33b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Vps33b APN 7 80285843 missense probably damaging 1.00
IGL01352:Vps33b APN 7 80285059 splice site probably null
IGL01863:Vps33b APN 7 80274311 critical splice donor site probably null
IGL01918:Vps33b APN 7 80287812 splice site probably null
IGL02152:Vps33b APN 7 80285069 missense probably benign 0.29
IGL02364:Vps33b APN 7 80287839 missense probably damaging 1.00
IGL02383:Vps33b APN 7 80285334 splice site probably null
IGL02669:Vps33b APN 7 80276038 splice site probably benign
IGL03104:Vps33b APN 7 80276083 missense probably damaging 1.00
IGL03333:Vps33b APN 7 80274225 splice site probably benign
PIT4651001:Vps33b UTSW 7 80290007 missense probably damaging 0.99
R0379:Vps33b UTSW 7 80283414 splice site probably null
R0971:Vps33b UTSW 7 80287899 missense possibly damaging 0.75
R1184:Vps33b UTSW 7 80282486 missense probably benign 0.02
R1639:Vps33b UTSW 7 80284353 missense probably damaging 1.00
R1693:Vps33b UTSW 7 80287893 missense probably damaging 1.00
R4502:Vps33b UTSW 7 80287907 missense possibly damaging 0.94
R4609:Vps33b UTSW 7 80291118 missense probably benign 0.00
R4748:Vps33b UTSW 7 80290048 missense probably damaging 1.00
R5083:Vps33b UTSW 7 80274641 missense probably damaging 0.99
R5304:Vps33b UTSW 7 80274253 missense probably damaging 1.00
R5774:Vps33b UTSW 7 80285340 missense probably benign 0.38
R5991:Vps33b UTSW 7 80283414 splice site probably null
R7085:Vps33b UTSW 7 80276089 missense probably benign 0.12
R7409:Vps33b UTSW 7 80285269 missense probably damaging 0.97
R8025:Vps33b UTSW 7 80290346 splice site probably benign
R8460:Vps33b UTSW 7 80287869 missense probably benign 0.04
X0018:Vps33b UTSW 7 80290565 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTTCAACATCCGAGAGAGCACTAGC -3'
(R):5'- TCTATCAGGAAGCCTCACTGAGCAC -3'

Sequencing Primer
(F):5'- CCGAGAGAGCACTAGCTACATTG -3'
(R):5'- CTGAAGATGGAACTGTTTACAGCC -3'
Posted On2013-05-09