Incidental Mutation 'R4680:Obox1'
ID349984
Institutional Source Beutler Lab
Gene Symbol Obox1
Ensembl Gene ENSMUSG00000054310
Gene Nameoocyte specific homeobox 1
Synonyms
MMRRC Submission 041933-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R4680 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location15388948-15556866 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 15556164 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 144 (N144I)
Ref Sequence ENSEMBL: ENSMUSP00000138010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067288] [ENSMUST00000086122] [ENSMUST00000172463] [ENSMUST00000172881] [ENSMUST00000173245] [ENSMUST00000173443] [ENSMUST00000181001]
Predicted Effect probably damaging
Transcript: ENSMUST00000067288
AA Change: N144I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067691
Gene: ENSMUSG00000054310
AA Change: N144I

DomainStartEndE-ValueType
HOX 94 156 2.18e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086122
SMART Domains Protein: ENSMUSP00000083291
Gene: ENSMUSG00000066772

DomainStartEndE-ValueType
HOX 94 156 1.84e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000172463
AA Change: N144I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133504
Gene: ENSMUSG00000054310
AA Change: N144I

DomainStartEndE-ValueType
HOX 94 156 2.18e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000172881
AA Change: N144I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134688
Gene: ENSMUSG00000054310
AA Change: N144I

DomainStartEndE-ValueType
HOX 94 156 2.18e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173245
AA Change: N144I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133496
Gene: ENSMUSG00000054310
AA Change: N144I

DomainStartEndE-ValueType
HOX 94 156 2.18e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173443
AA Change: N144I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134043
Gene: ENSMUSG00000054310
AA Change: N144I

DomainStartEndE-ValueType
HOX 94 156 2.18e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000181001
AA Change: N144I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138010
Gene: ENSMUSG00000054310
AA Change: N144I

DomainStartEndE-ValueType
HOX 94 156 2.18e-18 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 96% (48/50)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A T 2: 151,473,470 L96Q probably damaging Het
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
4931414P19Rik T C 14: 54,585,076 Y368C probably damaging Het
Acin1 T C 14: 54,686,758 N8S probably benign Het
Aspm T C 1: 139,480,671 V2432A probably benign Het
Atf2 A T 2: 73,828,681 probably null Het
B3gnt2 A G 11: 22,837,105 S28P probably damaging Het
Chil5 A G 3: 106,034,875 probably benign Het
Crybg2 CTTCCAGAGCCATGGACCCATCTTTTCCA CTTCCA 4: 134,072,718 probably null Het
Dennd3 A T 15: 73,533,376 H326L possibly damaging Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
Eprs T C 1: 185,386,278 V461A possibly damaging Het
Fhad1 G A 4: 142,011,547 Q31* probably null Het
Gpr26 A G 7: 131,974,353 T249A probably benign Het
Gtf2ird1 T A 5: 134,357,881 M958L probably damaging Het
Kat2b-ps A G 5: 93,391,440 noncoding transcript Het
Kdm2b A T 5: 122,934,786 V343E probably damaging Het
Lipi A G 16: 75,565,529 probably null Het
Ltb4r1 T C 14: 55,767,468 F76S probably damaging Het
Msantd2 A G 9: 37,523,091 Y209C probably damaging Het
Nid1 G A 13: 13,472,852 C401Y probably damaging Het
Olfr1051 T A 2: 86,276,173 I105F possibly damaging Het
Olfr1099 T C 2: 86,959,321 I46V possibly damaging Het
Olfr128 T C 17: 37,923,922 S119P probably damaging Het
Plec T C 15: 76,180,575 E1630G unknown Het
Ppp2r5e C T 12: 75,469,759 R218Q probably damaging Het
Prkdc A G 16: 15,772,030 T2586A probably benign Het
Ptprj T C 2: 90,460,496 N633S probably benign Het
Rab11fip2 T C 19: 59,936,020 N284S probably benign Het
Ropn1 A G 16: 34,677,305 Q189R possibly damaging Het
Rwdd2b A G 16: 87,437,062 probably null Het
Ryr2 A T 13: 11,595,233 S4236T probably benign Het
Sigmar1 A G 4: 41,741,251 M1T probably null Het
Sncg T A 14: 34,373,311 N79I probably benign Het
Traf3ip2 C T 10: 39,639,260 P345S possibly damaging Het
Ttn C T 2: 76,932,677 G3213S probably damaging Het
Uqcrc1 G A 9: 108,947,861 R77H probably damaging Het
Vps13d A C 4: 145,108,510 L2756R possibly damaging Het
Other mutations in Obox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0420:Obox1 UTSW 7 15556253 missense possibly damaging 0.90
R1374:Obox1 UTSW 7 15555501 splice site probably benign
R1527:Obox1 UTSW 7 15555325 missense probably damaging 1.00
R1984:Obox1 UTSW 7 15555210 missense probably benign 0.18
R4585:Obox1 UTSW 7 15556227 missense possibly damaging 0.66
R4586:Obox1 UTSW 7 15556227 missense possibly damaging 0.66
R4883:Obox1 UTSW 7 15556338 missense probably damaging 1.00
R5742:Obox1 UTSW 7 15555505 missense possibly damaging 0.73
R6331:Obox1 UTSW 7 15555369 missense probably benign 0.00
R6596:Obox1 UTSW 7 15555376 missense probably damaging 1.00
R7442:Obox1 UTSW 7 15555566 missense probably benign 0.00
R7919:Obox1 UTSW 7 15556331 nonsense probably null
R7946:Obox1 UTSW 7 15555531 missense probably benign 0.38
R8275:Obox1 UTSW 7 15556228 missense probably damaging 1.00
R8447:Obox1 UTSW 7 15555616 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACAGGGCATACTAGCTCAATC -3'
(R):5'- TTTGGGAATGGAATCCTCACC -3'

Sequencing Primer
(F):5'- GGGATGTCAAGTCATACACAGTC -3'
(R):5'- TTGGGAATGGAATCCTCACCAAATG -3'
Posted On2015-10-08