Incidental Mutation 'R4680:Uqcrc1'
ID 349989
Institutional Source Beutler Lab
Gene Symbol Uqcrc1
Ensembl Gene ENSMUSG00000025651
Gene Name ubiquinol-cytochrome c reductase core protein 1
Synonyms 1110032G10Rik
MMRRC Submission 041933-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock # R4680 (G1)
Quality Score 200
Status Validated
Chromosome 9
Chromosomal Location 108936633-108949623 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 108947861 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 77 (R77H)
Ref Sequence ENSEMBL: ENSMUSP00000141743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026743] [ENSMUST00000194047] [ENSMUST00000194469] [ENSMUST00000195738]
AlphaFold Q9CZ13
Predicted Effect possibly damaging
Transcript: ENSMUST00000026743
AA Change: R378H

PolyPhen 2 Score 0.786 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000026743
Gene: ENSMUSG00000025651
AA Change: R378H

DomainStartEndE-ValueType
low complexity region 17 37 N/A INTRINSIC
Pfam:Peptidase_M16 58 205 2.1e-54 PFAM
Pfam:Peptidase_M16_C 210 395 3.4e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192305
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192918
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193607
Predicted Effect probably benign
Transcript: ENSMUST00000194047
SMART Domains Protein: ENSMUSP00000141435
Gene: ENSMUSG00000025651

DomainStartEndE-ValueType
Pfam:Peptidase_M16 41 188 7.7e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000194469
AA Change: R77H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141743
Gene: ENSMUSG00000025651
AA Change: R77H

DomainStartEndE-ValueType
Pfam:Peptidase_M16_C 1 94 5.4e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195387
Predicted Effect probably benign
Transcript: ENSMUST00000195738
Meta Mutation Damage Score 0.1371 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 96% (48/50)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A T 2: 151,473,470 L96Q probably damaging Het
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
4931414P19Rik T C 14: 54,585,076 Y368C probably damaging Het
Acin1 T C 14: 54,686,758 N8S probably benign Het
Aspm T C 1: 139,480,671 V2432A probably benign Het
Atf2 A T 2: 73,828,681 probably null Het
B3gnt2 A G 11: 22,837,105 S28P probably damaging Het
Chil5 A G 3: 106,034,875 probably benign Het
Crybg2 CTTCCAGAGCCATGGACCCATCTTTTCCA CTTCCA 4: 134,072,718 probably null Het
Dennd3 A T 15: 73,533,376 H326L possibly damaging Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
Eprs T C 1: 185,386,278 V461A possibly damaging Het
Fhad1 G A 4: 142,011,547 Q31* probably null Het
Gpr26 A G 7: 131,974,353 T249A probably benign Het
Gtf2ird1 T A 5: 134,357,881 M958L probably damaging Het
Kat2b-ps A G 5: 93,391,440 noncoding transcript Het
Kdm2b A T 5: 122,934,786 V343E probably damaging Het
Lipi A G 16: 75,565,529 probably null Het
Ltb4r1 T C 14: 55,767,468 F76S probably damaging Het
Msantd2 A G 9: 37,523,091 Y209C probably damaging Het
Nid1 G A 13: 13,472,852 C401Y probably damaging Het
Obox1 A T 7: 15,556,164 N144I probably damaging Het
Olfr1051 T A 2: 86,276,173 I105F possibly damaging Het
Olfr1099 T C 2: 86,959,321 I46V possibly damaging Het
Olfr128 T C 17: 37,923,922 S119P probably damaging Het
Plec T C 15: 76,180,575 E1630G unknown Het
Ppp2r5e C T 12: 75,469,759 R218Q probably damaging Het
Prkdc A G 16: 15,772,030 T2586A probably benign Het
Ptprj T C 2: 90,460,496 N633S probably benign Het
Rab11fip2 T C 19: 59,936,020 N284S probably benign Het
Ropn1 A G 16: 34,677,305 Q189R possibly damaging Het
Rwdd2b A G 16: 87,437,062 probably null Het
Ryr2 A T 13: 11,595,233 S4236T probably benign Het
Sigmar1 A G 4: 41,741,251 M1T probably null Het
Sncg T A 14: 34,373,311 N79I probably benign Het
Traf3ip2 C T 10: 39,639,260 P345S possibly damaging Het
Ttn C T 2: 76,932,677 G3213S probably damaging Het
Vps13d A C 4: 145,108,510 L2756R possibly damaging Het
Other mutations in Uqcrc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Uqcrc1 APN 9 108948958 missense possibly damaging 0.62
IGL02332:Uqcrc1 APN 9 108947869 missense probably damaging 1.00
IGL02698:Uqcrc1 APN 9 108947943 critical splice donor site probably null
R0313:Uqcrc1 UTSW 9 108948574 missense possibly damaging 0.69
R0743:Uqcrc1 UTSW 9 108944705 nonsense probably null
R2027:Uqcrc1 UTSW 9 108947015 missense probably benign 0.06
R2513:Uqcrc1 UTSW 9 108936768 missense probably damaging 1.00
R4993:Uqcrc1 UTSW 9 108944810 missense probably damaging 1.00
R5223:Uqcrc1 UTSW 9 108942156 missense probably damaging 1.00
R5716:Uqcrc1 UTSW 9 108947405 missense probably benign
R5941:Uqcrc1 UTSW 9 108947486 unclassified probably benign
R6274:Uqcrc1 UTSW 9 108942156 missense probably damaging 1.00
R6598:Uqcrc1 UTSW 9 108947622 missense possibly damaging 0.93
R7132:Uqcrc1 UTSW 9 108949468 missense probably damaging 0.98
R7150:Uqcrc1 UTSW 9 108947858 missense probably benign 0.02
R7524:Uqcrc1 UTSW 9 108936759 missense possibly damaging 0.48
R8708:Uqcrc1 UTSW 9 108947040 missense probably damaging 0.97
R8889:Uqcrc1 UTSW 9 108937118 missense probably damaging 1.00
R8892:Uqcrc1 UTSW 9 108937118 missense probably damaging 1.00
R8975:Uqcrc1 UTSW 9 108947653 missense probably damaging 1.00
R9136:Uqcrc1 UTSW 9 108947905 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGCTTTGCCAGAGTTTCCAG -3'
(R):5'- ATGGTTCTCCTTTCTAAACATGGCC -3'

Sequencing Primer
(F):5'- AACATCTCCTACTCTGATACTGGG -3'
(R):5'- TGGCCACACTACAGCTTGAGTC -3'
Posted On 2015-10-08