Incidental Mutation 'R4680:Nid1'
ID349995
Institutional Source Beutler Lab
Gene Symbol Nid1
Ensembl Gene ENSMUSG00000005397
Gene Namenidogen 1
Synonymsentactin 1, nidogen-1, entactin, entactin-1
MMRRC Submission 041933-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.297) question?
Stock #R4680 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location13437551-13512269 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 13472852 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 401 (C401Y)
Ref Sequence ENSEMBL: ENSMUSP00000005532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005532]
PDB Structure NIDOGEN-1 G2/PERLECAN IG3 COMPLEX [X-RAY DIFFRACTION]
DOMAIN G2 OF MOUSE NIDOGEN-1 [X-RAY DIFFRACTION]
Crystal structure of Nidogen/Laminin Complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000005532
AA Change: C401Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005532
Gene: ENSMUSG00000005397
AA Change: C401Y

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
NIDO 106 270 3.8e-70 SMART
low complexity region 277 296 N/A INTRINSIC
EGF 387 424 3.46e0 SMART
G2F 425 664 7.69e-153 SMART
EGF 669 707 8.65e-1 SMART
EGF_CA 708 749 4.38e-11 SMART
EGF 759 799 8.19e-2 SMART
EGF_CA 800 838 1.42e-10 SMART
TY 873 921 1.17e-19 SMART
LY 968 1010 1.35e-2 SMART
LY 1011 1053 4.34e-15 SMART
LY 1054 1098 3.34e-16 SMART
LY 1099 1141 3.25e-5 SMART
LY 1142 1181 1.08e1 SMART
EGF 1209 1242 2.45e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220813
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222142
Meta Mutation Damage Score 0.9748 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nidogen family of basement membrane glycoproteins. The protein interacts with several other components of basement membranes, and may play a role in cell interactions with the extracellular matrix. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neurologic deficits including seizure-like symptoms and loss of muscle control in the hind legs, and show altered basement membrane morphology in selected locations including brain capillaries and the lens capsule. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A T 2: 151,473,470 L96Q probably damaging Het
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
4931414P19Rik T C 14: 54,585,076 Y368C probably damaging Het
Acin1 T C 14: 54,686,758 N8S probably benign Het
Aspm T C 1: 139,480,671 V2432A probably benign Het
Atf2 A T 2: 73,828,681 probably null Het
B3gnt2 A G 11: 22,837,105 S28P probably damaging Het
Chil5 A G 3: 106,034,875 probably benign Het
Crybg2 CTTCCAGAGCCATGGACCCATCTTTTCCA CTTCCA 4: 134,072,718 probably null Het
Dennd3 A T 15: 73,533,376 H326L possibly damaging Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
Eprs T C 1: 185,386,278 V461A possibly damaging Het
Fhad1 G A 4: 142,011,547 Q31* probably null Het
Gpr26 A G 7: 131,974,353 T249A probably benign Het
Gtf2ird1 T A 5: 134,357,881 M958L probably damaging Het
Kat2b-ps A G 5: 93,391,440 noncoding transcript Het
Kdm2b A T 5: 122,934,786 V343E probably damaging Het
Lipi A G 16: 75,565,529 probably null Het
Ltb4r1 T C 14: 55,767,468 F76S probably damaging Het
Msantd2 A G 9: 37,523,091 Y209C probably damaging Het
Obox1 A T 7: 15,556,164 N144I probably damaging Het
Olfr1051 T A 2: 86,276,173 I105F possibly damaging Het
Olfr1099 T C 2: 86,959,321 I46V possibly damaging Het
Olfr128 T C 17: 37,923,922 S119P probably damaging Het
Plec T C 15: 76,180,575 E1630G unknown Het
Ppp2r5e C T 12: 75,469,759 R218Q probably damaging Het
Prkdc A G 16: 15,772,030 T2586A probably benign Het
Ptprj T C 2: 90,460,496 N633S probably benign Het
Rab11fip2 T C 19: 59,936,020 N284S probably benign Het
Ropn1 A G 16: 34,677,305 Q189R possibly damaging Het
Rwdd2b A G 16: 87,437,062 probably null Het
Ryr2 A T 13: 11,595,233 S4236T probably benign Het
Sigmar1 A G 4: 41,741,251 M1T probably null Het
Sncg T A 14: 34,373,311 N79I probably benign Het
Traf3ip2 C T 10: 39,639,260 P345S possibly damaging Het
Ttn C T 2: 76,932,677 G3213S probably damaging Het
Uqcrc1 G A 9: 108,947,861 R77H probably damaging Het
Vps13d A C 4: 145,108,510 L2756R possibly damaging Het
Other mutations in Nid1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Nid1 APN 13 13476392 missense probably damaging 1.00
IGL02126:Nid1 APN 13 13489158 splice site probably null
IGL02452:Nid1 APN 13 13508720 missense probably benign 0.17
IGL02806:Nid1 APN 13 13468312 missense probably benign 0.00
IGL02966:Nid1 APN 13 13482221 missense probably benign 0.09
IGL03136:Nid1 APN 13 13500499 missense probably benign 0.33
IGL03411:Nid1 APN 13 13437889 missense probably damaging 0.98
R0384:Nid1 UTSW 13 13463836 missense probably benign 0.34
R0413:Nid1 UTSW 13 13482096 missense probably benign 0.01
R1257:Nid1 UTSW 13 13483790 missense probably benign 0.01
R1390:Nid1 UTSW 13 13476246 missense probably damaging 1.00
R1397:Nid1 UTSW 13 13508795 missense possibly damaging 0.94
R2057:Nid1 UTSW 13 13500473 missense probably benign 0.00
R2058:Nid1 UTSW 13 13500473 missense probably benign 0.00
R2059:Nid1 UTSW 13 13500473 missense probably benign 0.00
R2132:Nid1 UTSW 13 13509486 missense probably benign 0.04
R2140:Nid1 UTSW 13 13499668 missense probably damaging 1.00
R2195:Nid1 UTSW 13 13476203 missense probably damaging 1.00
R2237:Nid1 UTSW 13 13500485 missense probably benign
R2312:Nid1 UTSW 13 13500493 missense probably benign 0.15
R2987:Nid1 UTSW 13 13499673 missense probably benign 0.40
R3696:Nid1 UTSW 13 13486759 missense probably damaging 0.99
R3697:Nid1 UTSW 13 13486759 missense probably damaging 0.99
R3698:Nid1 UTSW 13 13486759 missense probably damaging 0.99
R3772:Nid1 UTSW 13 13476418 splice site probably benign
R4092:Nid1 UTSW 13 13486639 missense probably damaging 0.96
R4126:Nid1 UTSW 13 13476372 missense probably damaging 1.00
R4128:Nid1 UTSW 13 13476372 missense probably damaging 1.00
R4717:Nid1 UTSW 13 13506501 missense probably benign 0.00
R4783:Nid1 UTSW 13 13499741 missense probably damaging 0.97
R4812:Nid1 UTSW 13 13506468 nonsense probably null
R4834:Nid1 UTSW 13 13508823 missense probably damaging 1.00
R4915:Nid1 UTSW 13 13499586 missense possibly damaging 0.89
R4930:Nid1 UTSW 13 13510011 missense probably damaging 1.00
R5101:Nid1 UTSW 13 13483754 missense probably damaging 1.00
R5276:Nid1 UTSW 13 13468572 missense probably damaging 0.99
R5427:Nid1 UTSW 13 13483683 missense probably damaging 1.00
R5447:Nid1 UTSW 13 13437910 missense probably benign 0.00
R5507:Nid1 UTSW 13 13489037 nonsense probably null
R5663:Nid1 UTSW 13 13472834 missense probably damaging 1.00
R5868:Nid1 UTSW 13 13489157 critical splice donor site probably null
R6313:Nid1 UTSW 13 13463782 missense probably benign 0.01
R6761:Nid1 UTSW 13 13482035 missense probably benign 0.22
R7069:Nid1 UTSW 13 13508768 missense probably benign
R7208:Nid1 UTSW 13 13468385 missense probably benign 0.01
R7284:Nid1 UTSW 13 13489090 missense probably benign 0.01
R7434:Nid1 UTSW 13 13468464 missense probably benign
R7449:Nid1 UTSW 13 13482051 missense probably damaging 1.00
R7574:Nid1 UTSW 13 13468443 missense probably benign
R7762:Nid1 UTSW 13 13489045 missense probably damaging 1.00
R7887:Nid1 UTSW 13 13499733 missense possibly damaging 0.83
R8420:Nid1 UTSW 13 13437831 missense possibly damaging 0.81
R8506:Nid1 UTSW 13 13476174 missense probably damaging 0.99
R8756:Nid1 UTSW 13 13508801 missense probably benign 0.32
R8903:Nid1 UTSW 13 13463930 missense probably benign 0.00
X0028:Nid1 UTSW 13 13509534 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- ATGGCCACACTCATGCCATG -3'
(R):5'- TTCCAGAGACCAGGGCAAAG -3'

Sequencing Primer
(F):5'- CCCCTTGAAGGTCTTAGGTAGATGC -3'
(R):5'- GGGCAAAGGACACATCTATAAAC -3'
Posted On2015-10-08