Incidental Mutation 'R4680:4931414P19Rik'
ID349997
Institutional Source Beutler Lab
Gene Symbol 4931414P19Rik
Ensembl Gene ENSMUSG00000022179
Gene NameRIKEN cDNA 4931414P19 gene
Synonyms
MMRRC Submission 041933-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R4680 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location54583663-54605993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54585076 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 368 (Y368C)
Ref Sequence ENSEMBL: ENSMUSP00000022786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022786]
Predicted Effect probably damaging
Transcript: ENSMUST00000022786
AA Change: Y368C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022786
Gene: ENSMUSG00000022179
AA Change: Y368C

DomainStartEndE-ValueType
Pfam:DUF4616 2 538 1.5e-263 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082808
Predicted Effect probably benign
Transcript: ENSMUST00000227280
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228422
Meta Mutation Damage Score 0.6603 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 96% (48/50)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A T 2: 151,473,470 L96Q probably damaging Het
4930430F08Rik T C 10: 100,578,381 I139V probably benign Het
Acin1 T C 14: 54,686,758 N8S probably benign Het
Aspm T C 1: 139,480,671 V2432A probably benign Het
Atf2 A T 2: 73,828,681 probably null Het
B3gnt2 A G 11: 22,837,105 S28P probably damaging Het
Chil5 A G 3: 106,034,875 probably benign Het
Crybg2 CTTCCAGAGCCATGGACCCATCTTTTCCA CTTCCA 4: 134,072,718 probably null Het
Dennd3 A T 15: 73,533,376 H326L possibly damaging Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
Eprs T C 1: 185,386,278 V461A possibly damaging Het
Fhad1 G A 4: 142,011,547 Q31* probably null Het
Gpr26 A G 7: 131,974,353 T249A probably benign Het
Gtf2ird1 T A 5: 134,357,881 M958L probably damaging Het
Kat2b-ps A G 5: 93,391,440 noncoding transcript Het
Kdm2b A T 5: 122,934,786 V343E probably damaging Het
Lipi A G 16: 75,565,529 probably null Het
Ltb4r1 T C 14: 55,767,468 F76S probably damaging Het
Msantd2 A G 9: 37,523,091 Y209C probably damaging Het
Nid1 G A 13: 13,472,852 C401Y probably damaging Het
Obox1 A T 7: 15,556,164 N144I probably damaging Het
Olfr1051 T A 2: 86,276,173 I105F possibly damaging Het
Olfr1099 T C 2: 86,959,321 I46V possibly damaging Het
Olfr128 T C 17: 37,923,922 S119P probably damaging Het
Plec T C 15: 76,180,575 E1630G unknown Het
Ppp2r5e C T 12: 75,469,759 R218Q probably damaging Het
Prkdc A G 16: 15,772,030 T2586A probably benign Het
Ptprj T C 2: 90,460,496 N633S probably benign Het
Rab11fip2 T C 19: 59,936,020 N284S probably benign Het
Ropn1 A G 16: 34,677,305 Q189R possibly damaging Het
Rwdd2b A G 16: 87,437,062 probably null Het
Ryr2 A T 13: 11,595,233 S4236T probably benign Het
Sigmar1 A G 4: 41,741,251 M1T probably null Het
Sncg T A 14: 34,373,311 N79I probably benign Het
Traf3ip2 C T 10: 39,639,260 P345S possibly damaging Het
Ttn C T 2: 76,932,677 G3213S probably damaging Het
Uqcrc1 G A 9: 108,947,861 R77H probably damaging Het
Vps13d A C 4: 145,108,510 L2756R possibly damaging Het
Other mutations in 4931414P19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:4931414P19Rik APN 14 54595578 missense possibly damaging 0.56
IGL01448:4931414P19Rik APN 14 54585960 missense possibly damaging 0.77
IGL01934:4931414P19Rik APN 14 54585655 missense probably damaging 1.00
IGL02194:4931414P19Rik APN 14 54591355 nonsense probably null
IGL02721:4931414P19Rik APN 14 54585745 missense probably damaging 1.00
IGL03124:4931414P19Rik APN 14 54595139 missense probably benign 0.00
R0575:4931414P19Rik UTSW 14 54591252 missense possibly damaging 0.62
R2049:4931414P19Rik UTSW 14 54584987 nonsense probably null
R3829:4931414P19Rik UTSW 14 54584509 missense probably damaging 1.00
R3876:4931414P19Rik UTSW 14 54591400 nonsense probably null
R4392:4931414P19Rik UTSW 14 54584978 critical splice donor site probably null
R4805:4931414P19Rik UTSW 14 54595454 missense probably benign 0.00
R4940:4931414P19Rik UTSW 14 54591325 missense probably benign
R5091:4931414P19Rik UTSW 14 54585711 missense probably damaging 1.00
R5291:4931414P19Rik UTSW 14 54585937 missense probably damaging 1.00
R5594:4931414P19Rik UTSW 14 54584984 missense probably damaging 1.00
R6815:4931414P19Rik UTSW 14 54591153 missense probably damaging 1.00
R7031:4931414P19Rik UTSW 14 54595601 missense probably benign 0.23
R7229:4931414P19Rik UTSW 14 54595352 missense probably benign 0.00
R7616:4931414P19Rik UTSW 14 54585666 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTACTGTACCCTTTGGCC -3'
(R):5'- GAGGCTCTCTTCAAACCATAAGC -3'

Sequencing Primer
(F):5'- GGCCTGTCCCTCACATTACAG -3'
(R):5'- GAAGCCAGCCCTTTTGACC -3'
Posted On2015-10-08