Incidental Mutation 'R4681:Gpr45'
ID350008
Institutional Source Beutler Lab
Gene Symbol Gpr45
Ensembl Gene ENSMUSG00000041907
Gene NameG protein-coupled receptor 45
SynonymsPSP24alpha, 9230112G11Rik
MMRRC Submission 042015-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R4681 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location42952872-43035456 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43032908 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 237 (D237G)
Ref Sequence ENSEMBL: ENSMUSP00000135986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114761] [ENSMUST00000179766]
AlphaFold Q9EQQ4
Predicted Effect probably benign
Transcript: ENSMUST00000114761
AA Change: D237G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000110409
Gene: ENSMUSG00000041907
AA Change: D237G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 42 188 5.5e-9 PFAM
Pfam:7TM_GPCR_Srsx 45 340 1.9e-7 PFAM
Pfam:7tm_1 51 325 2.4e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158463
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179655
SMART Domains Protein: ENSMUSP00000136725
Gene: ENSMUSG00000096364

DomainStartEndE-ValueType
low complexity region 90 102 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179766
AA Change: D237G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000135986
Gene: ENSMUSG00000041907
AA Change: D237G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 42 189 7.1e-9 PFAM
Pfam:7TM_GPCR_Srsx 45 340 1.9e-7 PFAM
Pfam:7tm_1 51 325 2.1e-51 PFAM
Meta Mutation Damage Score 0.1047 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes a member of the G protein-coupled receptor (GPCR) family. Members of this protein family contain seven putative transmembrane domains and may mediate signaling processes to the interior of the cell via activation of heterotrimeric G proteins. This protein may function in the central nervous system. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 G T 1: 179,752,796 T1947K probably benign Het
Ak9 A C 10: 41,427,238 K1669T unknown Het
Atp4b T C 8: 13,389,700 E174G probably benign Het
Bcl6 A G 16: 23,968,453 probably benign Het
Brca2 C G 5: 150,552,398 probably null Het
Btnl4 A T 17: 34,470,101 probably null Het
C4a G T 17: 34,817,099 noncoding transcript Het
Cab39l A G 14: 59,499,605 D58G probably benign Het
Cacna2d3 A T 14: 29,293,135 M100K probably damaging Het
Car2 T A 3: 14,895,564 Y127* probably null Het
Cdhr1 T C 14: 37,096,237 N86S probably benign Het
Celsr3 A G 9: 108,827,754 I479V possibly damaging Het
Cfhr1 A T 1: 139,550,929 Y53* probably null Het
Cgrrf1 A G 14: 46,853,826 E269G probably benign Het
Clcn7 A T 17: 25,157,961 H636L probably damaging Het
Cox10 T G 11: 63,976,451 T240P possibly damaging Het
Crybg2 CTTCCAGAGCCATGGACCCATCTTTTCCA CTTCCA 4: 134,072,718 probably null Het
Dbt A G 3: 116,533,314 D104G probably damaging Het
F730035P03Rik T C 7: 99,780,218 noncoding transcript Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam186b T C 15: 99,280,890 K185R probably benign Het
Fat4 T C 3: 38,887,342 L128P probably damaging Het
Gbf1 A T 19: 46,280,550 Q1381L probably benign Het
Glp2r C T 11: 67,730,627 probably null Het
Gm18025 A G 12: 34,290,885 S70P probably benign Het
Hectd4 A T 5: 121,303,615 L1213F possibly damaging Het
Hydin T C 8: 110,506,471 V1734A possibly damaging Het
Kcnh5 A T 12: 75,007,623 S516T probably benign Het
Liph A C 16: 21,984,027 S97R probably benign Het
Mtcl1 T C 17: 66,449,144 T68A unknown Het
Nsun7 T A 5: 66,261,199 S91T probably benign Het
Olfr1436 T C 19: 12,299,049 T28A probably benign Het
Olfr790 A G 10: 129,501,564 I227V probably damaging Het
Pcdh20 A T 14: 88,467,616 N749K probably damaging Het
Pifo C A 3: 105,998,385 G148C probably damaging Het
Pot1b A T 17: 55,654,831 D582E probably benign Het
Pxdn T C 12: 30,012,326 I1212T probably benign Het
Ramp1 T C 1: 91,196,789 V24A probably benign Het
S100a8 T A 3: 90,669,583 D14E probably benign Het
Stk31 A G 6: 49,437,435 D501G probably benign Het
Tbc1d19 G A 5: 53,872,253 V319M probably damaging Het
Tbcel G T 9: 42,449,972 H93Q probably damaging Het
Traf3ip2 C T 10: 39,639,260 P345S possibly damaging Het
Trpm8 A T 1: 88,384,705 I1103F possibly damaging Het
Ttc19 T A 11: 62,309,091 C112* probably null Het
Unc5c T G 3: 141,768,613 probably null Het
Urb1 A T 16: 90,804,537 H115Q probably damaging Het
Vmn2r15 T A 5: 109,286,622 I739F probably damaging Het
Zcchc14 G T 8: 121,608,600 probably benign Het
Zfp408 G A 2: 91,645,786 P341L probably damaging Het
Zfp638 G A 6: 83,981,737 V1166M possibly damaging Het
Other mutations in Gpr45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Gpr45 APN 1 43032292 missense possibly damaging 0.77
IGL01528:Gpr45 APN 1 43033223 missense probably benign 0.00
IGL01833:Gpr45 APN 1 43032242 missense probably benign
IGL02034:Gpr45 APN 1 43033318 makesense probably null
IGL02230:Gpr45 APN 1 43032656 missense probably damaging 1.00
IGL02279:Gpr45 APN 1 43032838 missense probably damaging 0.96
IGL02394:Gpr45 APN 1 43030112 intron probably benign
IGL02795:Gpr45 APN 1 43032493 missense possibly damaging 0.82
IGL02902:Gpr45 APN 1 43033211 missense possibly damaging 0.67
IGL03017:Gpr45 APN 1 43032356 missense possibly damaging 0.95
expansive UTSW 1 43032838 missense probably damaging 0.96
extensive UTSW 1 43033058 missense probably damaging 1.00
R0368:Gpr45 UTSW 1 43033016 missense probably damaging 1.00
R2964:Gpr45 UTSW 1 43032508 missense possibly damaging 0.87
R2965:Gpr45 UTSW 1 43032508 missense possibly damaging 0.87
R2966:Gpr45 UTSW 1 43032508 missense possibly damaging 0.87
R4551:Gpr45 UTSW 1 43032790 missense probably benign 0.00
R4821:Gpr45 UTSW 1 43030453 intron probably benign
R4966:Gpr45 UTSW 1 43033120 missense probably benign 0.00
R5054:Gpr45 UTSW 1 43032649 missense probably benign 0.38
R5319:Gpr45 UTSW 1 43032838 missense probably damaging 0.96
R5667:Gpr45 UTSW 1 43033058 missense probably damaging 1.00
R5671:Gpr45 UTSW 1 43033058 missense probably damaging 1.00
R7250:Gpr45 UTSW 1 43032371 missense probably damaging 1.00
R8117:Gpr45 UTSW 1 43033315 missense probably damaging 1.00
R8393:Gpr45 UTSW 1 43032235 missense probably benign 0.00
R8752:Gpr45 UTSW 1 43032682 missense possibly damaging 0.94
R8927:Gpr45 UTSW 1 43033154 missense probably damaging 0.98
R8928:Gpr45 UTSW 1 43033154 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTTCACTGGCTGGACGTTCATG -3'
(R):5'- AGGCGCTGTAATAGAACCGC -3'

Sequencing Primer
(F):5'- TCATGGAGGTGCCTGCTC -3'
(R):5'- TGTAATAGAACCGCCGGCTG -3'
Posted On2015-10-08