Incidental Mutation 'R4681:Ahctf1'
ID350012
Institutional Source Beutler Lab
Gene Symbol Ahctf1
Ensembl Gene ENSMUSG00000026491
Gene NameAT hook containing transcription factor 1
Synonyms6230412P20Rik, Elys
MMRRC Submission 042015-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4681 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location179744894-179803680 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 179752796 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 1947 (T1947K)
Ref Sequence ENSEMBL: ENSMUSP00000027768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027768] [ENSMUST00000125816]
PDB Structure
Nucleoporin ELYS (aa1-494), Mus musculus [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000027768
AA Change: T1947K

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000027768
Gene: ENSMUSG00000026491
AA Change: T1947K

DomainStartEndE-ValueType
Pfam:ELYS-bb 1 489 1.6e-307 PFAM
Pfam:ELYS 722 955 2.5e-58 PFAM
low complexity region 1138 1155 N/A INTRINSIC
low complexity region 1180 1192 N/A INTRINSIC
low complexity region 1352 1366 N/A INTRINSIC
low complexity region 1597 1610 N/A INTRINSIC
low complexity region 1684 1694 N/A INTRINSIC
low complexity region 1834 1841 N/A INTRINSIC
low complexity region 1918 1935 N/A INTRINSIC
AT_hook 1955 1967 3.35e-1 SMART
low complexity region 2060 2066 N/A INTRINSIC
low complexity region 2073 2084 N/A INTRINSIC
low complexity region 2096 2108 N/A INTRINSIC
Blast:KISc 2164 2217 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000125816
Predicted Effect probably benign
Transcript: ENSMUST00000140489
SMART Domains Protein: ENSMUSP00000115253
Gene: ENSMUSG00000026491

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151734
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (59/59)
MGI Phenotype PHENOTYPE: Homozygous null mice die between E3.5 and E5.5. The inner cell mass cells exhibit impaired proliferation and apoptosis when grown in culture. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak9 A C 10: 41,427,238 K1669T unknown Het
Atp4b T C 8: 13,389,700 E174G probably benign Het
Bcl6 A G 16: 23,968,453 probably benign Het
Brca2 C G 5: 150,552,398 probably null Het
Btnl4 A T 17: 34,470,101 probably null Het
C4a G T 17: 34,817,099 noncoding transcript Het
Cab39l A G 14: 59,499,605 D58G probably benign Het
Cacna2d3 A T 14: 29,293,135 M100K probably damaging Het
Car2 T A 3: 14,895,564 Y127* probably null Het
Cdhr1 T C 14: 37,096,237 N86S probably benign Het
Celsr3 A G 9: 108,827,754 I479V possibly damaging Het
Cfhr1 A T 1: 139,550,929 Y53* probably null Het
Cgrrf1 A G 14: 46,853,826 E269G probably benign Het
Clcn7 A T 17: 25,157,961 H636L probably damaging Het
Cox10 T G 11: 63,976,451 T240P possibly damaging Het
Crybg2 CTTCCAGAGCCATGGACCCATCTTTTCCA CTTCCA 4: 134,072,718 probably null Het
Dbt A G 3: 116,533,314 D104G probably damaging Het
F730035P03Rik T C 7: 99,780,218 noncoding transcript Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam186b T C 15: 99,280,890 K185R probably benign Het
Fat4 T C 3: 38,887,342 L128P probably damaging Het
Gbf1 A T 19: 46,280,550 Q1381L probably benign Het
Glp2r C T 11: 67,730,627 probably null Het
Gm18025 A G 12: 34,290,885 S70P probably benign Het
Gpr45 A G 1: 43,032,908 D237G probably benign Het
Hectd4 A T 5: 121,303,615 L1213F possibly damaging Het
Hydin T C 8: 110,506,471 V1734A possibly damaging Het
Kcnh5 A T 12: 75,007,623 S516T probably benign Het
Liph A C 16: 21,984,027 S97R probably benign Het
Mtcl1 T C 17: 66,449,144 T68A unknown Het
Nsun7 T A 5: 66,261,199 S91T probably benign Het
Olfr1436 T C 19: 12,299,049 T28A probably benign Het
Olfr790 A G 10: 129,501,564 I227V probably damaging Het
Pcdh20 A T 14: 88,467,616 N749K probably damaging Het
Pifo C A 3: 105,998,385 G148C probably damaging Het
Pot1b A T 17: 55,654,831 D582E probably benign Het
Pxdn T C 12: 30,012,326 I1212T probably benign Het
Ramp1 T C 1: 91,196,789 V24A probably benign Het
S100a8 T A 3: 90,669,583 D14E probably benign Het
Stk31 A G 6: 49,437,435 D501G probably benign Het
Tbc1d19 G A 5: 53,872,253 V319M probably damaging Het
Tbcel G T 9: 42,449,972 H93Q probably damaging Het
Traf3ip2 C T 10: 39,639,260 P345S possibly damaging Het
Trpm8 A T 1: 88,384,705 I1103F possibly damaging Het
Ttc19 T A 11: 62,309,091 C112* probably null Het
Unc5c T G 3: 141,768,613 probably null Het
Urb1 A T 16: 90,804,537 H115Q probably damaging Het
Vmn2r15 T A 5: 109,286,622 I739F probably damaging Het
Zcchc14 G T 8: 121,608,600 probably benign Het
Zfp408 G A 2: 91,645,786 P341L probably damaging Het
Zfp638 G A 6: 83,981,737 V1166M possibly damaging Het
Other mutations in Ahctf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:Ahctf1 APN 1 179769131 missense probably damaging 1.00
IGL01714:Ahctf1 APN 1 179795877 missense probably damaging 0.99
IGL01787:Ahctf1 APN 1 179753322 missense probably benign
IGL01997:Ahctf1 APN 1 179755462 missense probably damaging 0.99
IGL02035:Ahctf1 APN 1 179766014 missense probably benign 0.00
IGL02158:Ahctf1 APN 1 179779652 missense possibly damaging 0.64
IGL02182:Ahctf1 APN 1 179753078 missense probably benign 0.00
IGL02298:Ahctf1 APN 1 179752479 missense probably benign 0.00
IGL02325:Ahctf1 APN 1 179776015 missense probably benign 0.14
IGL02619:Ahctf1 APN 1 179792451 missense possibly damaging 0.90
IGL02858:Ahctf1 APN 1 179769034 missense probably damaging 0.96
IGL02893:Ahctf1 APN 1 179776011 nonsense probably null
IGL02895:Ahctf1 APN 1 179793811 missense probably damaging 1.00
IGL03180:Ahctf1 APN 1 179775330 critical splice donor site probably null
IGL03220:Ahctf1 APN 1 179788202 missense probably benign 0.01
cerebro UTSW 1 179769414 missense probably damaging 0.99
R0003:Ahctf1 UTSW 1 179763473 missense probably benign 0.04
R0024:Ahctf1 UTSW 1 179752436 missense probably damaging 0.98
R0030:Ahctf1 UTSW 1 179752436 missense probably damaging 0.98
R0432:Ahctf1 UTSW 1 179784161 missense probably damaging 0.98
R0481:Ahctf1 UTSW 1 179760271 missense probably benign 0.00
R0600:Ahctf1 UTSW 1 179763468 critical splice donor site probably null
R0613:Ahctf1 UTSW 1 179769414 missense probably damaging 0.99
R0814:Ahctf1 UTSW 1 179762908 missense probably benign 0.26
R1055:Ahctf1 UTSW 1 179763486 missense possibly damaging 0.46
R1473:Ahctf1 UTSW 1 179776108 missense probably benign 0.30
R1473:Ahctf1 UTSW 1 179799279 missense probably damaging 0.99
R1689:Ahctf1 UTSW 1 179768383 missense probably damaging 0.96
R1778:Ahctf1 UTSW 1 179753015 missense possibly damaging 0.57
R1878:Ahctf1 UTSW 1 179775509 missense possibly damaging 0.96
R1925:Ahctf1 UTSW 1 179770653 missense probably damaging 0.98
R2118:Ahctf1 UTSW 1 179769452 missense probably damaging 1.00
R2122:Ahctf1 UTSW 1 179769452 missense probably damaging 1.00
R2124:Ahctf1 UTSW 1 179769452 missense probably damaging 1.00
R2373:Ahctf1 UTSW 1 179795796 missense probably damaging 1.00
R2509:Ahctf1 UTSW 1 179770693 missense possibly damaging 0.51
R2697:Ahctf1 UTSW 1 179752532 missense probably damaging 0.99
R3035:Ahctf1 UTSW 1 179753870 missense probably damaging 1.00
R3155:Ahctf1 UTSW 1 179755583 missense probably damaging 0.98
R3899:Ahctf1 UTSW 1 179777780 missense possibly damaging 0.95
R4036:Ahctf1 UTSW 1 179762616 missense possibly damaging 0.61
R4695:Ahctf1 UTSW 1 179753054 missense possibly damaging 0.78
R4735:Ahctf1 UTSW 1 179753399 missense probably benign 0.00
R4857:Ahctf1 UTSW 1 179799357 unclassified probably benign
R4898:Ahctf1 UTSW 1 179755512 missense probably benign 0.02
R4905:Ahctf1 UTSW 1 179748627 missense probably damaging 1.00
R5011:Ahctf1 UTSW 1 179784110 missense possibly damaging 0.92
R5013:Ahctf1 UTSW 1 179784110 missense possibly damaging 0.92
R5053:Ahctf1 UTSW 1 179786784 missense possibly damaging 0.82
R5207:Ahctf1 UTSW 1 179793594 intron probably benign
R5319:Ahctf1 UTSW 1 179769050 missense probably damaging 1.00
R5343:Ahctf1 UTSW 1 179770634 nonsense probably null
R5546:Ahctf1 UTSW 1 179754068 missense probably benign 0.01
R5718:Ahctf1 UTSW 1 179769339 missense possibly damaging 0.54
R5862:Ahctf1 UTSW 1 179788330 missense probably damaging 1.00
R5958:Ahctf1 UTSW 1 179746542 unclassified probably benign
R6010:Ahctf1 UTSW 1 179795813 missense possibly damaging 0.80
R6081:Ahctf1 UTSW 1 179781672 missense probably benign 0.07
R6093:Ahctf1 UTSW 1 179762952 missense probably benign 0.01
R6207:Ahctf1 UTSW 1 179777390 intron probably null
R6268:Ahctf1 UTSW 1 179763483 missense probably benign 0.08
R6656:Ahctf1 UTSW 1 179753513 missense probably benign 0.05
R6668:Ahctf1 UTSW 1 179752407 missense probably benign 0.04
R6788:Ahctf1 UTSW 1 179752634 missense probably benign 0.00
R6860:Ahctf1 UTSW 1 179753288 missense probably benign 0.04
R6998:Ahctf1 UTSW 1 179770915 nonsense probably null
R7082:Ahctf1 UTSW 1 179775333 missense probably benign 0.15
R7385:Ahctf1 UTSW 1 179753381 missense possibly damaging 0.66
R7414:Ahctf1 UTSW 1 179784105 missense probably benign 0.00
R7663:Ahctf1 UTSW 1 179790314 missense possibly damaging 0.66
R7673:Ahctf1 UTSW 1 179762846 missense probably benign 0.02
R7715:Ahctf1 UTSW 1 179770848 missense probably benign 0.00
R7819:Ahctf1 UTSW 1 179768315 missense probably benign
R7846:Ahctf1 UTSW 1 179787073 missense probably damaging 0.99
R7912:Ahctf1 UTSW 1 179753091 missense probably benign 0.00
R7929:Ahctf1 UTSW 1 179787073 missense probably damaging 0.99
R7993:Ahctf1 UTSW 1 179753091 missense probably benign 0.00
X0067:Ahctf1 UTSW 1 179777704 missense probably damaging 0.99
Z1177:Ahctf1 UTSW 1 179793730 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATGTCACCACTAGAGCAGC -3'
(R):5'- TGTCACAGAGCTGAGGAATGC -3'

Sequencing Primer
(F):5'- ACTAGAGCAGCTTCCTTATTTGG -3'
(R):5'- CTGAGGAATGCCAATTTAGAAGATAC -3'
Posted On2015-10-08