Incidental Mutation 'R4681:Pifo'
Institutional Source Beutler Lab
Gene Symbol Pifo
Ensembl Gene ENSMUSG00000010136
Gene Nameprimary cilia formation
Synonymspitchfork, 1700027A23Rik
MMRRC Submission 042015-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R4681 (G1)
Quality Score225
Status Validated
Chromosomal Location105996957-106014646 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 105998385 bp
Amino Acid Change Glycine to Cysteine at position 148 (G148C)
Ref Sequence ENSEMBL: ENSMUSP00000069454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010280] [ENSMUST00000066319]
Predicted Effect probably damaging
Transcript: ENSMUST00000010280
AA Change: G187C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000010280
Gene: ENSMUSG00000010136
AA Change: G187C

Pfam:SHIPPO-rpt 183 209 5.2e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000066319
AA Change: G148C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069454
Gene: ENSMUSG00000010136
AA Change: G148C

Pfam:SHIPPO-rpt 58 96 1.9e-2 PFAM
Pfam:SHIPPO-rpt 144 184 1.9e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198855
Meta Mutation Damage Score 0.5334 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (59/59)
MGI Phenotype PHENOTYPE: Heterozygous null embryos generated by tetraploid complementation display embryonic lethality with double outlet heart right ventricle, duplicated cilia and defects in cilia disassembly. A conditional allele activated in limb bub cultures doesn't interfere with cilia development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 G T 1: 179,752,796 T1947K probably benign Het
Ak9 A C 10: 41,427,238 K1669T unknown Het
Atp4b T C 8: 13,389,700 E174G probably benign Het
Bcl6 A G 16: 23,968,453 probably benign Het
Brca2 C G 5: 150,552,398 probably null Het
Btnl4 A T 17: 34,470,101 probably null Het
C4a G T 17: 34,817,099 noncoding transcript Het
Cab39l A G 14: 59,499,605 D58G probably benign Het
Cacna2d3 A T 14: 29,293,135 M100K probably damaging Het
Car2 T A 3: 14,895,564 Y127* probably null Het
Cdhr1 T C 14: 37,096,237 N86S probably benign Het
Celsr3 A G 9: 108,827,754 I479V possibly damaging Het
Cfhr1 A T 1: 139,550,929 Y53* probably null Het
Cgrrf1 A G 14: 46,853,826 E269G probably benign Het
Clcn7 A T 17: 25,157,961 H636L probably damaging Het
Cox10 T G 11: 63,976,451 T240P possibly damaging Het
Crybg2 CTTCCAGAGCCATGGACCCATCTTTTCCA CTTCCA 4: 134,072,718 probably null Het
Dbt A G 3: 116,533,314 D104G probably damaging Het
F730035P03Rik T C 7: 99,780,218 noncoding transcript Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam186b T C 15: 99,280,890 K185R probably benign Het
Fat4 T C 3: 38,887,342 L128P probably damaging Het
Gbf1 A T 19: 46,280,550 Q1381L probably benign Het
Glp2r C T 11: 67,730,627 probably null Het
Gm18025 A G 12: 34,290,885 S70P probably benign Het
Gpr45 A G 1: 43,032,908 D237G probably benign Het
Hectd4 A T 5: 121,303,615 L1213F possibly damaging Het
Hydin T C 8: 110,506,471 V1734A possibly damaging Het
Kcnh5 A T 12: 75,007,623 S516T probably benign Het
Liph A C 16: 21,984,027 S97R probably benign Het
Mtcl1 T C 17: 66,449,144 T68A unknown Het
Nsun7 T A 5: 66,261,199 S91T probably benign Het
Olfr1436 T C 19: 12,299,049 T28A probably benign Het
Olfr790 A G 10: 129,501,564 I227V probably damaging Het
Pcdh20 A T 14: 88,467,616 N749K probably damaging Het
Pot1b A T 17: 55,654,831 D582E probably benign Het
Pxdn T C 12: 30,012,326 I1212T probably benign Het
Ramp1 T C 1: 91,196,789 V24A probably benign Het
S100a8 T A 3: 90,669,583 D14E probably benign Het
Stk31 A G 6: 49,437,435 D501G probably benign Het
Tbc1d19 G A 5: 53,872,253 V319M probably damaging Het
Tbcel G T 9: 42,449,972 H93Q probably damaging Het
Traf3ip2 C T 10: 39,639,260 P345S possibly damaging Het
Trpm8 A T 1: 88,384,705 I1103F possibly damaging Het
Ttc19 T A 11: 62,309,091 C112* probably null Het
Unc5c T G 3: 141,768,613 probably null Het
Urb1 A T 16: 90,804,537 H115Q probably damaging Het
Vmn2r15 T A 5: 109,286,622 I739F probably damaging Het
Zcchc14 G T 8: 121,608,600 probably benign Het
Zfp408 G A 2: 91,645,786 P341L probably damaging Het
Zfp638 G A 6: 83,981,737 V1166M possibly damaging Het
Other mutations in Pifo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Pifo APN 3 106014508 missense probably benign 0.29
IGL01615:Pifo APN 3 105997207 splice site probably null
IGL02451:Pifo APN 3 106014504 missense probably benign 0.09
R0139:Pifo UTSW 3 105999570 missense possibly damaging 0.46
R1802:Pifo UTSW 3 106014550 missense possibly damaging 0.77
R1832:Pifo UTSW 3 106014596 missense possibly damaging 0.53
R4404:Pifo UTSW 3 106001368 missense probably benign 0.25
R4984:Pifo UTSW 3 106001494 start gained probably benign
R5245:Pifo UTSW 3 106014454 missense possibly damaging 0.92
R5308:Pifo UTSW 3 106001103 missense probably benign 0.02
R6015:Pifo UTSW 3 105999621 missense possibly damaging 0.47
R7430:Pifo UTSW 3 106014518 missense probably benign
R8253:Pifo UTSW 3 105998367 missense probably benign
Z1177:Pifo UTSW 3 105999605 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-10-08