Incidental Mutation 'R4681:Unc5c'
ID350020
Institutional Source Beutler Lab
Gene Symbol Unc5c
Ensembl Gene ENSMUSG00000059921
Gene Nameunc-5 netrin receptor C
SynonymsB130051O18Rik, Unc5h3
MMRRC Submission 042015-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4681 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location141465216-141834924 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to G at 141768613 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075282] [ENSMUST00000106236] [ENSMUST00000130636] [ENSMUST00000142762]
Predicted Effect probably null
Transcript: ENSMUST00000075282
SMART Domains Protein: ENSMUSP00000074758
Gene: ENSMUSG00000059921

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
SCOP:d2fcba2 64 164 9e-3 SMART
IGc2 179 246 2.72e-5 SMART
TSP1 263 314 8.54e-13 SMART
TSP1 319 368 1.18e-6 SMART
transmembrane domain 396 418 N/A INTRINSIC
ZU5 547 650 6.92e-63 SMART
low complexity region 695 704 N/A INTRINSIC
DEATH 857 948 6.68e-24 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106236
SMART Domains Protein: ENSMUSP00000101843
Gene: ENSMUSG00000059921

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
SCOP:d2fcba2 64 164 9e-3 SMART
IGc2 179 246 2.72e-5 SMART
TSP1 263 314 8.54e-13 SMART
TSP1 319 368 1.18e-6 SMART
transmembrane domain 377 399 N/A INTRINSIC
ZU5 528 631 6.92e-63 SMART
low complexity region 676 685 N/A INTRINSIC
DEATH 838 929 6.68e-24 SMART
Predicted Effect probably null
Transcript: ENSMUST00000130636
SMART Domains Protein: ENSMUSP00000117487
Gene: ENSMUSG00000059921

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
IGc2 105 172 2.72e-5 SMART
TSP1 189 240 8.54e-13 SMART
TSP1 245 294 1.18e-6 SMART
transmembrane domain 322 344 N/A INTRINSIC
ZU5 473 576 6.92e-63 SMART
low complexity region 621 630 N/A INTRINSIC
DEATH 783 874 6.68e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142762
SMART Domains Protein: ENSMUSP00000118212
Gene: ENSMUSG00000059921

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
SCOP:d2fcba2 64 164 9e-3 SMART
IGc2 179 246 2.72e-5 SMART
TSP1 263 314 8.54e-13 SMART
TSP1 319 368 1.18e-6 SMART
transmembrane domain 396 418 N/A INTRINSIC
ZU5 547 650 6.92e-63 SMART
low complexity region 695 704 N/A INTRINSIC
DEATH 857 948 6.68e-24 SMART
Meta Mutation Damage Score 0.9488 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the UNC-5 family of netrin receptors. Netrins are secreted proteins that direct axon extension and cell migration during neural development. They are bifunctional proteins that act as attractants for some cell types and as repellents for others, and these opposite actions are thought to be mediated by two classes of receptors. The UNC-5 family of receptors mediate the repellent response to netrin; they are transmembrane proteins containing 2 immunoglobulin (Ig)-like domains and 2 type I thrombospondin motifs in the extracellular region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants exhibit ataxia, and reduced size early in life. Mutants exhibit cerebellar defects including reduced size and ectopic cerebellar cells in the midbrain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 G T 1: 179,752,796 T1947K probably benign Het
Ak9 A C 10: 41,427,238 K1669T unknown Het
Atp4b T C 8: 13,389,700 E174G probably benign Het
Bcl6 A G 16: 23,968,453 probably benign Het
Brca2 C G 5: 150,552,398 probably null Het
Btnl4 A T 17: 34,470,101 probably null Het
C4a G T 17: 34,817,099 noncoding transcript Het
Cab39l A G 14: 59,499,605 D58G probably benign Het
Cacna2d3 A T 14: 29,293,135 M100K probably damaging Het
Car2 T A 3: 14,895,564 Y127* probably null Het
Cdhr1 T C 14: 37,096,237 N86S probably benign Het
Celsr3 A G 9: 108,827,754 I479V possibly damaging Het
Cfhr1 A T 1: 139,550,929 Y53* probably null Het
Cgrrf1 A G 14: 46,853,826 E269G probably benign Het
Clcn7 A T 17: 25,157,961 H636L probably damaging Het
Cox10 T G 11: 63,976,451 T240P possibly damaging Het
Crybg2 CTTCCAGAGCCATGGACCCATCTTTTCCA CTTCCA 4: 134,072,718 probably null Het
Dbt A G 3: 116,533,314 D104G probably damaging Het
F730035P03Rik T C 7: 99,780,218 noncoding transcript Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam186b T C 15: 99,280,890 K185R probably benign Het
Fat4 T C 3: 38,887,342 L128P probably damaging Het
Gbf1 A T 19: 46,280,550 Q1381L probably benign Het
Glp2r C T 11: 67,730,627 probably null Het
Gm18025 A G 12: 34,290,885 S70P probably benign Het
Gpr45 A G 1: 43,032,908 D237G probably benign Het
Hectd4 A T 5: 121,303,615 L1213F possibly damaging Het
Hydin T C 8: 110,506,471 V1734A possibly damaging Het
Kcnh5 A T 12: 75,007,623 S516T probably benign Het
Liph A C 16: 21,984,027 S97R probably benign Het
Mtcl1 T C 17: 66,449,144 T68A unknown Het
Nsun7 T A 5: 66,261,199 S91T probably benign Het
Olfr1436 T C 19: 12,299,049 T28A probably benign Het
Olfr790 A G 10: 129,501,564 I227V probably damaging Het
Pcdh20 A T 14: 88,467,616 N749K probably damaging Het
Pifo C A 3: 105,998,385 G148C probably damaging Het
Pot1b A T 17: 55,654,831 D582E probably benign Het
Pxdn T C 12: 30,012,326 I1212T probably benign Het
Ramp1 T C 1: 91,196,789 V24A probably benign Het
S100a8 T A 3: 90,669,583 D14E probably benign Het
Stk31 A G 6: 49,437,435 D501G probably benign Het
Tbc1d19 G A 5: 53,872,253 V319M probably damaging Het
Tbcel G T 9: 42,449,972 H93Q probably damaging Het
Traf3ip2 C T 10: 39,639,260 P345S possibly damaging Het
Trpm8 A T 1: 88,384,705 I1103F possibly damaging Het
Ttc19 T A 11: 62,309,091 C112* probably null Het
Urb1 A T 16: 90,804,537 H115Q probably damaging Het
Vmn2r15 T A 5: 109,286,622 I739F probably damaging Het
Zcchc14 G T 8: 121,608,600 probably benign Het
Zfp408 G A 2: 91,645,786 P341L probably damaging Het
Zfp638 G A 6: 83,981,737 V1166M possibly damaging Het
Other mutations in Unc5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Unc5c APN 3 141788940 missense probably damaging 0.99
IGL01089:Unc5c APN 3 141818202 splice site probably benign
IGL01478:Unc5c APN 3 141828451 missense probably damaging 1.00
IGL02083:Unc5c APN 3 141714647 missense probably damaging 0.99
IGL02269:Unc5c APN 3 141788982 missense probably damaging 1.00
IGL02565:Unc5c APN 3 141803919 missense probably damaging 1.00
IGL02973:Unc5c APN 3 141788890 missense probably benign 0.12
R0179:Unc5c UTSW 3 141818067 nonsense probably null
R0309:Unc5c UTSW 3 141733933 missense probably benign 0.01
R0371:Unc5c UTSW 3 141827522 missense probably benign 0.01
R0603:Unc5c UTSW 3 141771102 missense probably damaging 1.00
R0904:Unc5c UTSW 3 141803840 missense probably benign 0.08
R0907:Unc5c UTSW 3 141789033 missense probably damaging 0.99
R1300:Unc5c UTSW 3 141828543 missense possibly damaging 0.94
R1491:Unc5c UTSW 3 141789822 missense probably damaging 1.00
R1494:Unc5c UTSW 3 141827549 missense possibly damaging 0.93
R1674:Unc5c UTSW 3 141757837 missense possibly damaging 0.74
R1676:Unc5c UTSW 3 141757837 missense possibly damaging 0.74
R1726:Unc5c UTSW 3 141818103 missense probably damaging 1.00
R1750:Unc5c UTSW 3 141827517 missense possibly damaging 0.89
R1815:Unc5c UTSW 3 141757757 missense probably damaging 1.00
R2381:Unc5c UTSW 3 141678155 missense probably damaging 1.00
R2394:Unc5c UTSW 3 141678131 missense probably damaging 1.00
R2945:Unc5c UTSW 3 141789974 missense probably damaging 0.97
R4284:Unc5c UTSW 3 141714674 missense probably damaging 1.00
R4285:Unc5c UTSW 3 141714674 missense probably damaging 1.00
R4287:Unc5c UTSW 3 141714674 missense probably damaging 1.00
R4736:Unc5c UTSW 3 141816931 missense probably benign 0.00
R4740:Unc5c UTSW 3 141816931 missense probably benign 0.00
R4774:Unc5c UTSW 3 141828517 missense probably damaging 1.00
R4862:Unc5c UTSW 3 141789773 missense probably damaging 1.00
R4905:Unc5c UTSW 3 141801310 missense probably benign 0.19
R4921:Unc5c UTSW 3 141788966 missense probably damaging 1.00
R5150:Unc5c UTSW 3 141757793 missense probably damaging 1.00
R5559:Unc5c UTSW 3 141803787 missense probably damaging 1.00
R5562:Unc5c UTSW 3 141768530 missense probably damaging 1.00
R5643:Unc5c UTSW 3 141678125 missense probably damaging 1.00
R5644:Unc5c UTSW 3 141678125 missense probably damaging 1.00
R5775:Unc5c UTSW 3 141828520 missense probably damaging 1.00
R5912:Unc5c UTSW 3 141789006 missense probably damaging 1.00
R6154:Unc5c UTSW 3 141678153 missense probably damaging 0.97
R6547:Unc5c UTSW 3 141790019 missense probably benign 0.16
R6558:Unc5c UTSW 3 141789729 missense probably damaging 0.98
R7104:Unc5c UTSW 3 141733904 missense probably damaging 1.00
R7113:Unc5c UTSW 3 141801293 missense probably benign 0.00
R7282:Unc5c UTSW 3 141677990 missense probably damaging 0.98
R7317:Unc5c UTSW 3 141789942 missense probably benign 0.00
R7787:Unc5c UTSW 3 141768552 missense probably damaging 1.00
R7873:Unc5c UTSW 3 141827549 missense probably benign 0.04
R7896:Unc5c UTSW 3 141771161 missense possibly damaging 0.73
R7936:Unc5c UTSW 3 141828477 missense possibly damaging 0.48
R8041:Unc5c UTSW 3 141465784 missense possibly damaging 0.92
R8277:Unc5c UTSW 3 141768612 critical splice donor site probably null
R8669:Unc5c UTSW 3 141803943 missense possibly damaging 0.91
X0018:Unc5c UTSW 3 141714739 missense probably damaging 1.00
X0065:Unc5c UTSW 3 141827661 missense probably damaging 1.00
Z1088:Unc5c UTSW 3 141733900 missense probably damaging 1.00
Z1176:Unc5c UTSW 3 141678010 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTCTGGTCCATATGCTGTG -3'
(R):5'- ATGGTGCTTGGCCCCTTATG -3'

Sequencing Primer
(F):5'- GGACATTCCTGTATTTCTAACCCAC -3'
(R):5'- GCATGTTGCATGTTTAGATGATAAAG -3'
Posted On2015-10-08