Incidental Mutation 'R4681:Nsun7'
ID350022
Institutional Source Beutler Lab
Gene Symbol Nsun7
Ensembl Gene ENSMUSG00000029206
Gene NameNOL1/NOP2/Sun domain family, member 7
Synonyms4921525L17Rik
MMRRC Submission 042015-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4681 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location66259897-66298026 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 66261199 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 91 (S91T)
Ref Sequence ENSEMBL: ENSMUSP00000144498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031109] [ENSMUST00000201100] [ENSMUST00000202994]
Predicted Effect probably benign
Transcript: ENSMUST00000031109
AA Change: S91T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000031109
Gene: ENSMUSG00000029206
AA Change: S91T

DomainStartEndE-ValueType
Pfam:Nol1_Nop2_Fmu 394 477 4.2e-7 PFAM
low complexity region 543 555 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127901
AA Change: N221K
Predicted Effect not run
Transcript: ENSMUST00000131585
AA Change: S14T
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200891
Predicted Effect probably benign
Transcript: ENSMUST00000201100
AA Change: S91T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000144520
Gene: ENSMUSG00000029206
AA Change: S91T

DomainStartEndE-ValueType
Pfam:Nol1_Nop2_Fmu 312 479 4.3e-9 PFAM
low complexity region 543 555 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202994
AA Change: S91T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000144498
Gene: ENSMUSG00000029206
AA Change: S91T

DomainStartEndE-ValueType
PDB:2B9E|A 205 479 5e-17 PDB
low complexity region 509 521 N/A INTRINSIC
Meta Mutation Damage Score 0.1055 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: This gene encodes a member of the NOL1/NOP2/sun domain RNA methyltransferase family. Mice with a mutation in this gene exhibit male sterility due to impaired sperm motility. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Males homozygous for an ENU-induced mutation are either infertile or subfertile. Mutant sperm exhibit poor progressive motility linked to rigidity of the flagellar midpiece and abnormal electron density patterns in the mitochondrial sheath. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 G T 1: 179,752,796 T1947K probably benign Het
Ak9 A C 10: 41,427,238 K1669T unknown Het
Atp4b T C 8: 13,389,700 E174G probably benign Het
Bcl6 A G 16: 23,968,453 probably benign Het
Brca2 C G 5: 150,552,398 probably null Het
Btnl4 A T 17: 34,470,101 probably null Het
C4a G T 17: 34,817,099 noncoding transcript Het
Cab39l A G 14: 59,499,605 D58G probably benign Het
Cacna2d3 A T 14: 29,293,135 M100K probably damaging Het
Car2 T A 3: 14,895,564 Y127* probably null Het
Cdhr1 T C 14: 37,096,237 N86S probably benign Het
Celsr3 A G 9: 108,827,754 I479V possibly damaging Het
Cfhr1 A T 1: 139,550,929 Y53* probably null Het
Cgrrf1 A G 14: 46,853,826 E269G probably benign Het
Clcn7 A T 17: 25,157,961 H636L probably damaging Het
Cox10 T G 11: 63,976,451 T240P possibly damaging Het
Crybg2 CTTCCAGAGCCATGGACCCATCTTTTCCA CTTCCA 4: 134,072,718 probably null Het
Dbt A G 3: 116,533,314 D104G probably damaging Het
F730035P03Rik T C 7: 99,780,218 noncoding transcript Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam186b T C 15: 99,280,890 K185R probably benign Het
Fat4 T C 3: 38,887,342 L128P probably damaging Het
Gbf1 A T 19: 46,280,550 Q1381L probably benign Het
Glp2r C T 11: 67,730,627 probably null Het
Gm18025 A G 12: 34,290,885 S70P probably benign Het
Gpr45 A G 1: 43,032,908 D237G probably benign Het
Hectd4 A T 5: 121,303,615 L1213F possibly damaging Het
Hydin T C 8: 110,506,471 V1734A possibly damaging Het
Kcnh5 A T 12: 75,007,623 S516T probably benign Het
Liph A C 16: 21,984,027 S97R probably benign Het
Mtcl1 T C 17: 66,449,144 T68A unknown Het
Olfr1436 T C 19: 12,299,049 T28A probably benign Het
Olfr790 A G 10: 129,501,564 I227V probably damaging Het
Pcdh20 A T 14: 88,467,616 N749K probably damaging Het
Pifo C A 3: 105,998,385 G148C probably damaging Het
Pot1b A T 17: 55,654,831 D582E probably benign Het
Pxdn T C 12: 30,012,326 I1212T probably benign Het
Ramp1 T C 1: 91,196,789 V24A probably benign Het
S100a8 T A 3: 90,669,583 D14E probably benign Het
Stk31 A G 6: 49,437,435 D501G probably benign Het
Tbc1d19 G A 5: 53,872,253 V319M probably damaging Het
Tbcel G T 9: 42,449,972 H93Q probably damaging Het
Traf3ip2 C T 10: 39,639,260 P345S possibly damaging Het
Trpm8 A T 1: 88,384,705 I1103F possibly damaging Het
Ttc19 T A 11: 62,309,091 C112* probably null Het
Unc5c T G 3: 141,768,613 probably null Het
Urb1 A T 16: 90,804,537 H115Q probably damaging Het
Vmn2r15 T A 5: 109,286,622 I739F probably damaging Het
Zcchc14 G T 8: 121,608,600 probably benign Het
Zfp408 G A 2: 91,645,786 P341L probably damaging Het
Zfp638 G A 6: 83,981,737 V1166M possibly damaging Het
Other mutations in Nsun7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Nsun7 APN 5 66289503 missense probably benign 0.00
IGL01013:Nsun7 APN 5 66283601 missense possibly damaging 0.87
IGL01355:Nsun7 APN 5 66294868 missense probably damaging 1.00
IGL01768:Nsun7 APN 5 66278700 missense probably benign 0.11
IGL01914:Nsun7 APN 5 66276634 missense probably damaging 1.00
IGL01990:Nsun7 APN 5 66261073 missense probably damaging 1.00
IGL02477:Nsun7 APN 5 66276649 missense probably damaging 0.99
R0071:Nsun7 UTSW 5 66264045 missense probably benign 0.00
R0071:Nsun7 UTSW 5 66264045 missense probably benign 0.00
R0079:Nsun7 UTSW 5 66295513 missense probably benign 0.00
R0255:Nsun7 UTSW 5 66289408 splice site probably benign
R0503:Nsun7 UTSW 5 66283581 splice site probably benign
R0540:Nsun7 UTSW 5 66283634 missense probably damaging 0.98
R1416:Nsun7 UTSW 5 66261080 missense probably damaging 0.98
R1471:Nsun7 UTSW 5 66284229 missense probably benign 0.00
R1942:Nsun7 UTSW 5 66284245 missense probably benign 0.00
R1981:Nsun7 UTSW 5 66261214 missense probably damaging 0.99
R2037:Nsun7 UTSW 5 66261086 missense probably benign 0.06
R2098:Nsun7 UTSW 5 66283712 missense probably damaging 0.98
R2226:Nsun7 UTSW 5 66261219 nonsense probably null
R2996:Nsun7 UTSW 5 66295554 missense probably benign 0.01
R3882:Nsun7 UTSW 5 66278640 missense probably damaging 0.99
R4678:Nsun7 UTSW 5 66261064 missense probably benign 0.00
R4997:Nsun7 UTSW 5 66295839 missense probably benign 0.02
R6108:Nsun7 UTSW 5 66295799 missense probably damaging 0.99
R6465:Nsun7 UTSW 5 66295586 missense probably benign 0.35
R6500:Nsun7 UTSW 5 66295484 missense probably benign 0.11
R6746:Nsun7 UTSW 5 66283737 critical splice donor site probably null
R6925:Nsun7 UTSW 5 66277072 missense probably damaging 1.00
R7032:Nsun7 UTSW 5 66264035 missense probably benign 0.02
R7084:Nsun7 UTSW 5 66295421 missense probably damaging 1.00
R7098:Nsun7 UTSW 5 66260983 missense probably damaging 0.98
R7216:Nsun7 UTSW 5 66278657 missense probably damaging 1.00
R7276:Nsun7 UTSW 5 66277141 missense probably benign 0.03
R7803:Nsun7 UTSW 5 66276541 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAACTCTTCAACCGTCGTCC -3'
(R):5'- ACACATATGTTTGAGGAGCTAGGC -3'

Sequencing Primer
(F):5'- TCTTCAACCGTCGTCCTAGAAAAAC -3'
(R):5'- GGAGCTAGGCTGCATTCCATTAATTC -3'
Posted On2015-10-08