Incidental Mutation 'R4681:Stk31'
ID350026
Institutional Source Beutler Lab
Gene Symbol Stk31
Ensembl Gene ENSMUSG00000023403
Gene Nameserine threonine kinase 31
SynonymsC330007K24Rik
MMRRC Submission 042015-MU
Accession Numbers

Genbank: NM_029916; MGI: 1924735

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4681 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location49395604-49469501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49437435 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 501 (D501G)
Ref Sequence ENSEMBL: ENSMUSP00000127545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024171] [ENSMUST00000163954] [ENSMUST00000172459]
Predicted Effect probably benign
Transcript: ENSMUST00000024171
AA Change: D501G

PolyPhen 2 Score 0.369 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000024171
Gene: ENSMUSG00000023403
AA Change: D501G

DomainStartEndE-ValueType
TUDOR 81 135 1.34e-8 SMART
coiled coil region 298 345 N/A INTRINSIC
Pfam:Pkinase_Tyr 768 932 4.6e-9 PFAM
Pfam:Pkinase 794 973 3.8e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163954
AA Change: D501G

PolyPhen 2 Score 0.369 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000127545
Gene: ENSMUSG00000023403
AA Change: D501G

DomainStartEndE-ValueType
TUDOR 81 135 1.34e-8 SMART
coiled coil region 298 345 N/A INTRINSIC
Pfam:Pkinase_Tyr 784 922 7.4e-9 PFAM
Pfam:Pkinase 794 940 1.8e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167846
SMART Domains Protein: ENSMUSP00000130561
Gene: ENSMUSG00000023403

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 105 287 1e-6 PFAM
Pfam:Pkinase 184 284 1.9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172459
SMART Domains Protein: ENSMUSP00000132896
Gene: ENSMUSG00000023403

DomainStartEndE-ValueType
TUDOR 81 135 1.34e-8 SMART
coiled coil region 298 345 N/A INTRINSIC
Pfam:Pkinase_Tyr 739 890 5.2e-9 PFAM
Pfam:Pkinase 749 917 1.1e-16 PFAM
Meta Mutation Damage Score 0.0804 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to a mouse gene that encodes a putative protein kinase with a tudor domain, and shows testis-specific expression. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display normal embryonic development and spermatogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, other(1) Gene trapped(3)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 G T 1: 179,752,796 T1947K probably benign Het
Ak9 A C 10: 41,427,238 K1669T unknown Het
Atp4b T C 8: 13,389,700 E174G probably benign Het
Bcl6 A G 16: 23,968,453 probably benign Het
Brca2 C G 5: 150,552,398 probably null Het
Btnl4 A T 17: 34,470,101 probably null Het
C4a G T 17: 34,817,099 noncoding transcript Het
Cab39l A G 14: 59,499,605 D58G probably benign Het
Cacna2d3 A T 14: 29,293,135 M100K probably damaging Het
Car2 T A 3: 14,895,564 Y127* probably null Het
Cdhr1 T C 14: 37,096,237 N86S probably benign Het
Celsr3 A G 9: 108,827,754 I479V possibly damaging Het
Cfhr1 A T 1: 139,550,929 Y53* probably null Het
Cgrrf1 A G 14: 46,853,826 E269G probably benign Het
Clcn7 A T 17: 25,157,961 H636L probably damaging Het
Cox10 T G 11: 63,976,451 T240P possibly damaging Het
Crybg2 CTTCCAGAGCCATGGACCCATCTTTTCCA CTTCCA 4: 134,072,718 probably null Het
Dbt A G 3: 116,533,314 D104G probably damaging Het
F730035P03Rik T C 7: 99,780,218 noncoding transcript Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam186b T C 15: 99,280,890 K185R probably benign Het
Fat4 T C 3: 38,887,342 L128P probably damaging Het
Gbf1 A T 19: 46,280,550 Q1381L probably benign Het
Glp2r C T 11: 67,730,627 probably null Het
Gm18025 A G 12: 34,290,885 S70P probably benign Het
Gpr45 A G 1: 43,032,908 D237G probably benign Het
Hectd4 A T 5: 121,303,615 L1213F possibly damaging Het
Hydin T C 8: 110,506,471 V1734A possibly damaging Het
Kcnh5 A T 12: 75,007,623 S516T probably benign Het
Liph A C 16: 21,984,027 S97R probably benign Het
Mtcl1 T C 17: 66,449,144 T68A unknown Het
Nsun7 T A 5: 66,261,199 S91T probably benign Het
Olfr1436 T C 19: 12,299,049 T28A probably benign Het
Olfr790 A G 10: 129,501,564 I227V probably damaging Het
Pcdh20 A T 14: 88,467,616 N749K probably damaging Het
Pifo C A 3: 105,998,385 G148C probably damaging Het
Pot1b A T 17: 55,654,831 D582E probably benign Het
Pxdn T C 12: 30,012,326 I1212T probably benign Het
Ramp1 T C 1: 91,196,789 V24A probably benign Het
S100a8 T A 3: 90,669,583 D14E probably benign Het
Tbc1d19 G A 5: 53,872,253 V319M probably damaging Het
Tbcel G T 9: 42,449,972 H93Q probably damaging Het
Traf3ip2 C T 10: 39,639,260 P345S possibly damaging Het
Trpm8 A T 1: 88,384,705 I1103F possibly damaging Het
Ttc19 T A 11: 62,309,091 C112* probably null Het
Unc5c T G 3: 141,768,613 probably null Het
Urb1 A T 16: 90,804,537 H115Q probably damaging Het
Vmn2r15 T A 5: 109,286,622 I739F probably damaging Het
Zcchc14 G T 8: 121,608,600 probably benign Het
Zfp408 G A 2: 91,645,786 P341L probably damaging Het
Zfp638 G A 6: 83,981,737 V1166M possibly damaging Het
Other mutations in Stk31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Stk31 APN 6 49437443 missense probably benign 0.41
IGL02479:Stk31 APN 6 49421688 missense probably damaging 0.99
IGL02490:Stk31 APN 6 49417535 missense probably benign 0.04
IGL03165:Stk31 APN 6 49445264 missense probably damaging 0.98
3-1:Stk31 UTSW 6 49417202 nonsense probably null
R0016:Stk31 UTSW 6 49437377 missense probably damaging 1.00
R0016:Stk31 UTSW 6 49437377 missense probably damaging 1.00
R0039:Stk31 UTSW 6 49442258 missense probably damaging 1.00
R0616:Stk31 UTSW 6 49423485 missense probably damaging 1.00
R0732:Stk31 UTSW 6 49417495 missense probably benign 0.00
R0975:Stk31 UTSW 6 49423409 missense probably damaging 1.00
R1127:Stk31 UTSW 6 49409207 missense probably damaging 1.00
R1705:Stk31 UTSW 6 49423384 missense possibly damaging 0.94
R1711:Stk31 UTSW 6 49469304 missense probably benign 0.10
R1892:Stk31 UTSW 6 49438474 missense probably damaging 1.00
R1942:Stk31 UTSW 6 49439127 missense probably damaging 0.98
R1953:Stk31 UTSW 6 49446478 critical splice donor site probably null
R2149:Stk31 UTSW 6 49439218 missense possibly damaging 0.80
R2281:Stk31 UTSW 6 49417250 missense probably damaging 1.00
R3438:Stk31 UTSW 6 49437521 missense probably benign 0.00
R5333:Stk31 UTSW 6 49469152 missense probably benign 0.00
R5492:Stk31 UTSW 6 49398243 missense probably damaging 1.00
R5782:Stk31 UTSW 6 49469136 missense probably benign 0.00
R5820:Stk31 UTSW 6 49417285 missense probably damaging 0.96
R5931:Stk31 UTSW 6 49469302 missense probably benign 0.05
R6012:Stk31 UTSW 6 49469309 missense probably damaging 0.96
R6254:Stk31 UTSW 6 49421697 missense probably benign 0.08
R6281:Stk31 UTSW 6 49469180 missense possibly damaging 0.93
R6294:Stk31 UTSW 6 49417344 missense probably benign 0.18
R6401:Stk31 UTSW 6 49423438 missense probably damaging 1.00
R7289:Stk31 UTSW 6 49438459 missense probably benign 0.05
R7490:Stk31 UTSW 6 49439232 critical splice donor site probably null
R7659:Stk31 UTSW 6 49423406 missense probably benign 0.00
Z1088:Stk31 UTSW 6 49417188 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGGAGACTTTTAATCACTGCTTG -3'
(R):5'- GTCAACTTTTGAACAAGGAAGGAAC -3'

Sequencing Primer
(F):5'- ATCACTGCTTGTTTTACTAAGGC -3'
(R):5'- TTTGAACAAGGAAGGAACAGAATTAG -3'
Posted On2015-10-08