Incidental Mutation 'R4681:Traf3ip2'
ID350035
Institutional Source Beutler Lab
Gene Symbol Traf3ip2
Ensembl Gene ENSMUSG00000019842
Gene NameTRAF3 interacting protein 2
SynonymsAct1
MMRRC Submission 042015-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R4681 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location39612934-39655307 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 39639260 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 345 (P345S)
Ref Sequence ENSEMBL: ENSMUSP00000019987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019987]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019987
AA Change: P345S

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000019987
Gene: ENSMUSG00000019842
AA Change: P345S

DomainStartEndE-ValueType
low complexity region 22 37 N/A INTRINSIC
low complexity region 94 106 N/A INTRINSIC
low complexity region 164 179 N/A INTRINSIC
Pfam:SEFIR 391 533 1.2e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129693
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133302
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139356
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139429
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143651
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145971
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151921
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153261
Meta Mutation Damage Score 0.052 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in regulating responses to cytokines by members of the Rel/NF-kappaB transcription factor family. These factors play a central role in innate immunity in response to pathogens, inflammatory signals and stress. This gene product interacts with TRAF proteins (tumor necrosis factor receptor-associated factors) and either I-kappaB kinase or MAP kinase to activate either NF-kappaB or Jun kinase. Several alternative transcripts encoding different isoforms have been identified. Another transcript, which does not encode a protein and is transcribed in the opposite orientation, has been identified. Overexpression of this transcript has been shown to reduce expression of at least one of the protein encoding transcripts, suggesting it has a regulatory role in the expression of this gene. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for one null allele exhibit splenomegaly, lymphadenopathy, increased number of B cells, defective IL-17 signaling, and increased immunoglobulin levels (including auto-antibodies) whereas mice homozygous for another null allele lack these features except the defect in IL-17 signaling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 G T 1: 179,752,796 T1947K probably benign Het
Ak9 A C 10: 41,427,238 K1669T unknown Het
Atp4b T C 8: 13,389,700 E174G probably benign Het
Bcl6 A G 16: 23,968,453 probably benign Het
Brca2 C G 5: 150,552,398 probably null Het
Btnl4 A T 17: 34,470,101 probably null Het
C4a G T 17: 34,817,099 noncoding transcript Het
Cab39l A G 14: 59,499,605 D58G probably benign Het
Cacna2d3 A T 14: 29,293,135 M100K probably damaging Het
Car2 T A 3: 14,895,564 Y127* probably null Het
Cdhr1 T C 14: 37,096,237 N86S probably benign Het
Celsr3 A G 9: 108,827,754 I479V possibly damaging Het
Cfhr1 A T 1: 139,550,929 Y53* probably null Het
Cgrrf1 A G 14: 46,853,826 E269G probably benign Het
Clcn7 A T 17: 25,157,961 H636L probably damaging Het
Cox10 T G 11: 63,976,451 T240P possibly damaging Het
Crybg2 CTTCCAGAGCCATGGACCCATCTTTTCCA CTTCCA 4: 134,072,718 probably null Het
Dbt A G 3: 116,533,314 D104G probably damaging Het
F730035P03Rik T C 7: 99,780,218 noncoding transcript Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam186b T C 15: 99,280,890 K185R probably benign Het
Fat4 T C 3: 38,887,342 L128P probably damaging Het
Gbf1 A T 19: 46,280,550 Q1381L probably benign Het
Glp2r C T 11: 67,730,627 probably null Het
Gm18025 A G 12: 34,290,885 S70P probably benign Het
Gpr45 A G 1: 43,032,908 D237G probably benign Het
Hectd4 A T 5: 121,303,615 L1213F possibly damaging Het
Hydin T C 8: 110,506,471 V1734A possibly damaging Het
Kcnh5 A T 12: 75,007,623 S516T probably benign Het
Liph A C 16: 21,984,027 S97R probably benign Het
Mtcl1 T C 17: 66,449,144 T68A unknown Het
Nsun7 T A 5: 66,261,199 S91T probably benign Het
Olfr1436 T C 19: 12,299,049 T28A probably benign Het
Olfr790 A G 10: 129,501,564 I227V probably damaging Het
Pcdh20 A T 14: 88,467,616 N749K probably damaging Het
Pifo C A 3: 105,998,385 G148C probably damaging Het
Pot1b A T 17: 55,654,831 D582E probably benign Het
Pxdn T C 12: 30,012,326 I1212T probably benign Het
Ramp1 T C 1: 91,196,789 V24A probably benign Het
S100a8 T A 3: 90,669,583 D14E probably benign Het
Stk31 A G 6: 49,437,435 D501G probably benign Het
Tbc1d19 G A 5: 53,872,253 V319M probably damaging Het
Tbcel G T 9: 42,449,972 H93Q probably damaging Het
Trpm8 A T 1: 88,384,705 I1103F possibly damaging Het
Ttc19 T A 11: 62,309,091 C112* probably null Het
Unc5c T G 3: 141,768,613 probably null Het
Urb1 A T 16: 90,804,537 H115Q probably damaging Het
Vmn2r15 T A 5: 109,286,622 I739F probably damaging Het
Zcchc14 G T 8: 121,608,600 probably benign Het
Zfp408 G A 2: 91,645,786 P341L probably damaging Het
Zfp638 G A 6: 83,981,737 V1166M possibly damaging Het
Other mutations in Traf3ip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01941:Traf3ip2 APN 10 39634660 missense probably benign
IGL02097:Traf3ip2 APN 10 39654479 missense probably damaging 0.99
IGL02530:Traf3ip2 APN 10 39646906 missense possibly damaging 0.80
IGL02957:Traf3ip2 APN 10 39654410 missense probably damaging 1.00
IGL03034:Traf3ip2 APN 10 39626219 missense probably damaging 1.00
IGL03123:Traf3ip2 APN 10 39639222 missense possibly damaging 0.87
IGL03386:Traf3ip2 APN 10 39645708 missense probably benign 0.03
R0328:Traf3ip2 UTSW 10 39634673 missense probably damaging 0.96
R1282:Traf3ip2 UTSW 10 39626405 missense probably damaging 1.00
R1913:Traf3ip2 UTSW 10 39625940 missense probably benign 0.00
R2975:Traf3ip2 UTSW 10 39626540 missense probably benign 0.00
R4575:Traf3ip2 UTSW 10 39634654 missense probably damaging 0.97
R4576:Traf3ip2 UTSW 10 39634654 missense probably damaging 0.97
R4578:Traf3ip2 UTSW 10 39634654 missense probably damaging 0.97
R4670:Traf3ip2 UTSW 10 39639260 missense possibly damaging 0.76
R4680:Traf3ip2 UTSW 10 39639260 missense possibly damaging 0.76
R4710:Traf3ip2 UTSW 10 39639260 missense possibly damaging 0.76
R4742:Traf3ip2 UTSW 10 39639260 missense possibly damaging 0.76
R4760:Traf3ip2 UTSW 10 39645739 missense probably damaging 1.00
R4934:Traf3ip2 UTSW 10 39626100 missense probably damaging 1.00
R5079:Traf3ip2 UTSW 10 39626477 missense probably damaging 1.00
R5959:Traf3ip2 UTSW 10 39641341 missense probably benign 0.13
R6421:Traf3ip2 UTSW 10 39639404 splice site probably null
R6462:Traf3ip2 UTSW 10 39639247 missense probably benign 0.00
R7156:Traf3ip2 UTSW 10 39626177 missense possibly damaging 0.61
X0020:Traf3ip2 UTSW 10 39654519 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTTTACAAAGGAAACTCCATGCCC -3'
(R):5'- TTCCGGATGAGTGGCTAAGC -3'

Sequencing Primer
(F):5'- CACCTCTCCATCTGTGTCAG -3'
(R):5'- GCCAAACCCTCTGAGCATG -3'
Posted On2015-10-08