Incidental Mutation 'R0267:Jam3'
ID35004
Institutional Source Beutler Lab
Gene Symbol Jam3
Ensembl Gene ENSMUSG00000031990
Gene Namejunction adhesion molecule 3
Synonyms1110002N23Rik, Jcam3, JAM-C, JAM-3
MMRRC Submission 038493-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.564) question?
Stock #R0267 (G1)
Quality Score201
Status Validated
Chromosome9
Chromosomal Location27097384-27155421 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27106405 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 29 (I29T)
Ref Sequence ENSEMBL: ENSMUSP00000034472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034472]
Predicted Effect probably benign
Transcript: ENSMUST00000034472
AA Change: I29T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000034472
Gene: ENSMUSG00000031990
AA Change: I29T

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
IG 38 136 2.7e-9 SMART
IGc2 151 226 8.12e-13 SMART
transmembrane domain 245 267 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167074
SMART Domains Protein: ENSMUSP00000128003
Gene: ENSMUSG00000031990

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 18 24 N/A INTRINSIC
IG 38 136 2.7e-9 SMART
Pfam:C2-set_2 138 206 4.8e-7 PFAM
Pfam:Ig_3 139 206 7.1e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217654
Meta Mutation Damage Score 0.0993 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.7%
  • 10x: 96.2%
  • 20x: 94.0%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Tight junctions represent one mode of cell-to-cell adhesion in epithelial or endothelial cell sheets, forming continuous seals around cells and serving as a physical barrier to prevent solutes and water from passing freely through the paracellular space. The protein encoded by this immunoglobulin superfamily gene member is localized in the tight junctions between high endothelial cells. Unlike other proteins in this family, the this protein is unable to adhere to leukocyte cell lines and only forms weak homotypic interactions. The encoded protein is a member of the junctional adhesion molecule protein family and acts as a receptor for another member of this family. A mutation in an intron of this gene is associated with hemorrhagic destruction of the brain, subependymal calcification, and congenital cataracts. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Apr 2011]
PHENOTYPE: Approximately 60% of mice homozygous for a targeted mutation exhibit postnatal lethality. Males are infertile and display small testes and arrested differentiation of round spermatids into spermatozoa, as shown by the absence of acrosomes, elongated nuclei, and morphological signs of polarization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A G 4: 53,046,105 F1721S probably damaging Het
Adgrb1 G A 15: 74,529,389 R78H probably damaging Het
Adgrd1 G A 5: 129,139,594 A342T probably benign Het
Adrb1 A T 19: 56,723,491 K374* probably null Het
Aldh18a1 C A 19: 40,573,789 V264F probably benign Het
Aldh1l2 C T 10: 83,522,687 probably benign Het
Alox15 T A 11: 70,346,153 H393L probably damaging Het
Aox2 A G 1: 58,339,446 probably benign Het
Appbp2 T C 11: 85,201,462 Y297C probably damaging Het
Atxn2l T G 7: 126,493,207 Q950P probably damaging Het
Bicd1 A T 6: 149,517,042 D737V probably damaging Het
C9 T C 15: 6,467,458 I212T probably benign Het
Ccdc63 A T 5: 122,117,044 probably benign Het
Chst1 C A 2: 92,613,606 P141Q probably damaging Het
Cped1 T A 6: 22,119,476 F311L probably damaging Het
D6Wsu163e T A 6: 126,946,491 H113Q probably benign Het
Dcn A T 10: 97,506,483 probably benign Het
Dmbx1 C T 4: 115,918,112 A324T probably benign Het
Dock10 G T 1: 80,512,454 Q1618K probably damaging Het
Dpyd A G 3: 118,917,272 E443G probably benign Het
Espl1 T C 15: 102,313,017 V953A possibly damaging Het
Exosc10 T C 4: 148,562,756 L174P probably damaging Het
Foxg1 A G 12: 49,385,582 Y366C probably damaging Het
Fxyd3 T C 7: 31,070,734 probably benign Het
Gbp2 T C 3: 142,630,106 V189A probably benign Het
Gins4 T C 8: 23,229,410 probably benign Het
Gm12789 A G 4: 101,988,122 T3A probably benign Het
Gnb1l T C 16: 18,548,089 probably benign Het
Gtpbp3 T C 8: 71,491,497 L295S probably damaging Het
Hrh4 C A 18: 13,022,398 Y331* probably null Het
Hsd11b1 A T 1: 193,241,397 Y52N probably damaging Het
Kctd16 T A 18: 40,530,877 I353N probably benign Het
Lama4 G T 10: 39,028,639 G246C probably damaging Het
Lhx3 T A 2: 26,203,028 M137L probably benign Het
Morc2a T C 11: 3,678,567 I340T probably benign Het
Myo7a A C 7: 98,054,624 I1969S probably benign Het
Olfr1471 T A 19: 13,445,428 C139S probably damaging Het
Olfr304 T C 7: 86,386,267 E131G possibly damaging Het
Olfr429 A G 1: 174,089,166 N42S probably damaging Het
Pclo T C 5: 14,681,180 L3232P unknown Het
Polr1a T G 6: 71,974,139 I1407M probably damaging Het
Ppip5k2 A G 1: 97,728,997 V817A probably damaging Het
Rbfox3 T C 11: 118,495,240 T280A probably benign Het
Rfx3 T C 19: 27,793,788 D521G probably benign Het
Scn5a C T 9: 119,543,135 V223I probably damaging Het
Sgsm3 T G 15: 81,006,602 M119R probably damaging Het
Slc6a7 T A 18: 60,996,711 M608L probably benign Het
Slit2 A G 5: 48,182,331 probably benign Het
Steap2 T A 5: 5,673,561 I440F probably benign Het
Syn2 T G 6: 115,254,150 probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tfb2m G A 1: 179,533,638 H262Y probably benign Het
Trmt1l A G 1: 151,457,675 probably benign Het
Trpm6 C A 19: 18,823,378 P819T probably benign Het
Ttn G A 2: 76,743,689 A25620V probably damaging Het
Ubn2 T C 6: 38,482,618 probably null Het
Vars T C 17: 35,011,596 probably benign Het
Vip A T 10: 5,644,004 D119V possibly damaging Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Vps33b T C 7: 80,286,054 I405T possibly damaging Het
Zbtb21 T A 16: 97,952,100 S356C probably damaging Het
Zdhhc6 A T 19: 55,308,930 S237T probably benign Het
Zfp142 G A 1: 74,576,064 A427V probably benign Het
Zfp692 T A 11: 58,314,314 V463E possibly damaging Het
Zmynd8 A T 2: 165,828,402 I384N probably damaging Het
Other mutations in Jam3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Jam3 APN 9 27101892 missense probably damaging 1.00
IGL01311:Jam3 APN 9 27098723 missense probably damaging 0.99
IGL01729:Jam3 APN 9 27105525 missense probably damaging 1.00
IGL03233:Jam3 APN 9 27101921 missense probably damaging 1.00
IGL03275:Jam3 APN 9 27101249 missense probably damaging 0.99
R0547:Jam3 UTSW 9 27098888 missense probably damaging 1.00
R0899:Jam3 UTSW 9 27098957 missense probably damaging 1.00
R1499:Jam3 UTSW 9 27106405 missense possibly damaging 0.93
R3926:Jam3 UTSW 9 27106405 missense possibly damaging 0.93
R4044:Jam3 UTSW 9 27101863 critical splice donor site probably null
R4977:Jam3 UTSW 9 27098373 missense probably damaging 0.96
R6527:Jam3 UTSW 9 27155344 missense unknown
R6759:Jam3 UTSW 9 27101980 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- ACACAACAGCCATCCTGAACATTCTT -3'
(R):5'- GGATACACACAACAGTCACTCTGTTCAA -3'

Sequencing Primer
(F):5'- acacaactatctatactccatctcc -3'
(R):5'- AAGGAAAAGTTGTGGCCTCC -3'
Posted On2013-05-09