Incidental Mutation 'R4681:Cacna2d3'
ID 350044
Institutional Source Beutler Lab
Gene Symbol Cacna2d3
Ensembl Gene ENSMUSG00000021991
Gene Name calcium channel, voltage-dependent, alpha2/delta subunit 3
Synonyms alpha 2 delta-3, alpha2delta3
MMRRC Submission 042015-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4681 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 28626900-29443821 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 29015092 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 100 (M100K)
Ref Sequence ENSEMBL: ENSMUSP00000153444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022567] [ENSMUST00000225733] [ENSMUST00000225863]
AlphaFold Q9Z1L5
Predicted Effect probably damaging
Transcript: ENSMUST00000022567
AA Change: M366K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022567
Gene: ENSMUSG00000021991
AA Change: M366K

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
Blast:WNT1 28 103 2e-33 BLAST
Pfam:VWA_N 113 229 6.8e-40 PFAM
VWA 254 439 4.13e-24 SMART
Pfam:Cache_1 452 548 3e-32 PFAM
low complexity region 1070 1088 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000225733
AA Change: M100K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000225863
AA Change: M100K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225953
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226048
Meta Mutation Damage Score 0.8537 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the alpha-2/delta subunit family, a protein in the voltage-dependent calcium channel complex. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. Research on a highly similar protein in rabbit suggests the protein described in this record is cleaved into alpha-2 and delta subunits. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have a decreased startle reflex and occasional animals show increased aggression and hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 G T 1: 179,580,361 (GRCm39) T1947K probably benign Het
Ak9 A C 10: 41,303,234 (GRCm39) K1669T unknown Het
Atp4b T C 8: 13,439,700 (GRCm39) E174G probably benign Het
Bcl6 A G 16: 23,787,203 (GRCm39) probably benign Het
Brca2 C G 5: 150,475,863 (GRCm39) probably null Het
Btnl4 A T 17: 34,689,075 (GRCm39) probably null Het
C4a G T 17: 35,036,075 (GRCm39) noncoding transcript Het
Cab39l A G 14: 59,737,054 (GRCm39) D58G probably benign Het
Car2 T A 3: 14,960,624 (GRCm39) Y127* probably null Het
Cdhr1 T C 14: 36,818,194 (GRCm39) N86S probably benign Het
Celsr3 A G 9: 108,704,953 (GRCm39) I479V possibly damaging Het
Cfhr1 A T 1: 139,478,667 (GRCm39) Y53* probably null Het
Cgrrf1 A G 14: 47,091,283 (GRCm39) E269G probably benign Het
Cimap3 C A 3: 105,905,701 (GRCm39) G148C probably damaging Het
Clcn7 A T 17: 25,376,935 (GRCm39) H636L probably damaging Het
Cox10 T G 11: 63,867,277 (GRCm39) T240P possibly damaging Het
Crybg2 CTTCCAGAGCCATGGACCCATCTTTTCCA CTTCCA 4: 133,800,029 (GRCm39) probably null Het
Dbt A G 3: 116,326,963 (GRCm39) D104G probably damaging Het
F730035P03Rik T C 7: 99,429,425 (GRCm39) noncoding transcript Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fam186b T C 15: 99,178,771 (GRCm39) K185R probably benign Het
Fat4 T C 3: 38,941,491 (GRCm39) L128P probably damaging Het
Gbf1 A T 19: 46,268,989 (GRCm39) Q1381L probably benign Het
Glp2r C T 11: 67,621,453 (GRCm39) probably null Het
Gm18025 A G 12: 34,340,884 (GRCm39) S70P probably benign Het
Gpr45 A G 1: 43,072,068 (GRCm39) D237G probably benign Het
Hectd4 A T 5: 121,441,678 (GRCm39) L1213F possibly damaging Het
Hydin T C 8: 111,233,103 (GRCm39) V1734A possibly damaging Het
Kcnh5 A T 12: 75,054,397 (GRCm39) S516T probably benign Het
Liph A C 16: 21,802,777 (GRCm39) S97R probably benign Het
Mtcl1 T C 17: 66,756,139 (GRCm39) T68A unknown Het
Nsun7 T A 5: 66,418,542 (GRCm39) S91T probably benign Het
Or5an10 T C 19: 12,276,413 (GRCm39) T28A probably benign Het
Or6c75 A G 10: 129,337,433 (GRCm39) I227V probably damaging Het
Pcdh20 A T 14: 88,705,052 (GRCm39) N749K probably damaging Het
Pot1b A T 17: 55,961,831 (GRCm39) D582E probably benign Het
Pxdn T C 12: 30,062,325 (GRCm39) I1212T probably benign Het
Ramp1 T C 1: 91,124,511 (GRCm39) V24A probably benign Het
S100a8 T A 3: 90,576,890 (GRCm39) D14E probably benign Het
Stk31 A G 6: 49,414,369 (GRCm39) D501G probably benign Het
Tbc1d19 G A 5: 54,029,595 (GRCm39) V319M probably damaging Het
Tbcel G T 9: 42,361,268 (GRCm39) H93Q probably damaging Het
Traf3ip2 C T 10: 39,515,256 (GRCm39) P345S possibly damaging Het
Trpm8 A T 1: 88,312,427 (GRCm39) I1103F possibly damaging Het
Ttc19 T A 11: 62,199,917 (GRCm39) C112* probably null Het
Unc5c T G 3: 141,474,374 (GRCm39) probably null Het
Urb1 A T 16: 90,601,425 (GRCm39) H115Q probably damaging Het
Vmn2r15 T A 5: 109,434,488 (GRCm39) I739F probably damaging Het
Zcchc14 G T 8: 122,335,339 (GRCm39) probably benign Het
Zfp408 G A 2: 91,476,131 (GRCm39) P341L probably damaging Het
Zfp638 G A 6: 83,958,719 (GRCm39) V1166M possibly damaging Het
Other mutations in Cacna2d3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01113:Cacna2d3 APN 14 29,022,688 (GRCm39) splice site probably benign
IGL01150:Cacna2d3 APN 14 28,905,598 (GRCm39) missense possibly damaging 0.95
IGL01390:Cacna2d3 APN 14 28,665,548 (GRCm39) missense possibly damaging 0.91
IGL01626:Cacna2d3 APN 14 28,665,564 (GRCm39) missense possibly damaging 0.90
IGL02127:Cacna2d3 APN 14 28,785,832 (GRCm39) unclassified probably benign
IGL02237:Cacna2d3 APN 14 29,068,954 (GRCm39) missense probably benign 0.09
IGL02274:Cacna2d3 APN 14 28,678,827 (GRCm39) splice site probably null
IGL02604:Cacna2d3 APN 14 29,015,066 (GRCm39) missense possibly damaging 0.61
IGL02806:Cacna2d3 APN 14 29,073,907 (GRCm39) splice site probably null
IGL02838:Cacna2d3 APN 14 29,022,785 (GRCm39) critical splice acceptor site probably null
IGL02894:Cacna2d3 APN 14 28,786,276 (GRCm39) critical splice acceptor site probably null
IGL03061:Cacna2d3 APN 14 28,780,388 (GRCm39) missense probably damaging 0.98
IGL03117:Cacna2d3 APN 14 29,189,909 (GRCm39) missense probably damaging 1.00
IGL03265:Cacna2d3 APN 14 28,674,243 (GRCm39) missense probably damaging 0.98
IGL03266:Cacna2d3 APN 14 29,022,705 (GRCm39) missense probably benign 0.01
IGL03396:Cacna2d3 APN 14 29,442,834 (GRCm39) nonsense probably null
R0094:Cacna2d3 UTSW 14 28,892,460 (GRCm39) critical splice donor site probably null
R0326:Cacna2d3 UTSW 14 28,767,601 (GRCm39) missense probably damaging 0.96
R0485:Cacna2d3 UTSW 14 29,256,476 (GRCm39) missense possibly damaging 0.89
R0669:Cacna2d3 UTSW 14 29,189,906 (GRCm39) missense probably benign 0.40
R0730:Cacna2d3 UTSW 14 28,704,322 (GRCm39) missense probably benign 0.02
R0736:Cacna2d3 UTSW 14 28,780,585 (GRCm39) missense probably benign 0.02
R1073:Cacna2d3 UTSW 14 28,767,580 (GRCm39) missense probably damaging 0.99
R1116:Cacna2d3 UTSW 14 28,786,278 (GRCm39) splice site probably benign
R1312:Cacna2d3 UTSW 14 28,767,625 (GRCm39) missense probably benign 0.00
R1467:Cacna2d3 UTSW 14 29,055,736 (GRCm39) missense possibly damaging 0.67
R1467:Cacna2d3 UTSW 14 29,055,736 (GRCm39) missense possibly damaging 0.67
R1501:Cacna2d3 UTSW 14 28,703,137 (GRCm39) missense probably damaging 1.00
R1525:Cacna2d3 UTSW 14 28,694,199 (GRCm39) missense probably benign 0.01
R1574:Cacna2d3 UTSW 14 29,073,779 (GRCm39) missense probably damaging 1.00
R1574:Cacna2d3 UTSW 14 29,073,779 (GRCm39) missense probably damaging 1.00
R1866:Cacna2d3 UTSW 14 28,691,171 (GRCm39) missense probably damaging 1.00
R2403:Cacna2d3 UTSW 14 28,627,259 (GRCm39) missense probably benign 0.38
R2981:Cacna2d3 UTSW 14 28,785,875 (GRCm39) missense probably damaging 1.00
R3715:Cacna2d3 UTSW 14 29,068,880 (GRCm39) missense probably damaging 1.00
R3791:Cacna2d3 UTSW 14 28,905,538 (GRCm39) missense probably benign 0.03
R3847:Cacna2d3 UTSW 14 29,069,077 (GRCm39) critical splice donor site probably null
R3849:Cacna2d3 UTSW 14 29,069,077 (GRCm39) critical splice donor site probably null
R3850:Cacna2d3 UTSW 14 29,069,077 (GRCm39) critical splice donor site probably null
R4558:Cacna2d3 UTSW 14 28,825,670 (GRCm39) missense possibly damaging 0.70
R4594:Cacna2d3 UTSW 14 28,704,303 (GRCm39) missense probably benign 0.13
R4868:Cacna2d3 UTSW 14 28,678,743 (GRCm39) splice site probably null
R4965:Cacna2d3 UTSW 14 28,704,289 (GRCm39) missense probably benign 0.07
R5133:Cacna2d3 UTSW 14 29,015,135 (GRCm39) missense possibly damaging 0.75
R5311:Cacna2d3 UTSW 14 29,068,987 (GRCm39) missense probably damaging 0.99
R5432:Cacna2d3 UTSW 14 28,665,512 (GRCm39) critical splice donor site probably null
R5873:Cacna2d3 UTSW 14 29,442,891 (GRCm39) missense probably benign 0.31
R6103:Cacna2d3 UTSW 14 29,118,446 (GRCm39) missense probably damaging 1.00
R6197:Cacna2d3 UTSW 14 28,630,278 (GRCm39) missense probably benign 0.38
R6396:Cacna2d3 UTSW 14 29,118,522 (GRCm39) missense probably benign 0.03
R6626:Cacna2d3 UTSW 14 28,786,143 (GRCm39) unclassified probably benign
R6632:Cacna2d3 UTSW 14 28,627,222 (GRCm39) makesense probably null
R6706:Cacna2d3 UTSW 14 28,846,642 (GRCm39) critical splice acceptor site probably null
R6765:Cacna2d3 UTSW 14 28,777,934 (GRCm39) missense probably damaging 1.00
R6945:Cacna2d3 UTSW 14 28,691,275 (GRCm39) intron probably benign
R7009:Cacna2d3 UTSW 14 28,691,322 (GRCm39) start codon destroyed probably null
R7069:Cacna2d3 UTSW 14 28,691,260 (GRCm39) intron probably benign
R7146:Cacna2d3 UTSW 14 29,443,654 (GRCm39) missense unknown
R7427:Cacna2d3 UTSW 14 28,786,232 (GRCm39) missense probably damaging 1.00
R7428:Cacna2d3 UTSW 14 28,786,232 (GRCm39) missense probably damaging 1.00
R7445:Cacna2d3 UTSW 14 28,780,575 (GRCm39) missense possibly damaging 0.88
R7505:Cacna2d3 UTSW 14 28,767,501 (GRCm39) splice site probably null
R7560:Cacna2d3 UTSW 14 28,780,378 (GRCm39) missense probably benign 0.18
R7703:Cacna2d3 UTSW 14 28,765,503 (GRCm39) missense possibly damaging 0.90
R8042:Cacna2d3 UTSW 14 28,826,995 (GRCm39) splice site probably benign
R8096:Cacna2d3 UTSW 14 28,825,657 (GRCm39) missense possibly damaging 0.62
R8280:Cacna2d3 UTSW 14 28,704,328 (GRCm39) missense probably benign 0.25
R8814:Cacna2d3 UTSW 14 28,819,772 (GRCm39) missense probably damaging 1.00
R8838:Cacna2d3 UTSW 14 28,691,220 (GRCm39) missense probably benign 0.03
R8864:Cacna2d3 UTSW 14 29,055,735 (GRCm39) missense probably damaging 1.00
R9103:Cacna2d3 UTSW 14 29,068,971 (GRCm39) missense probably damaging 1.00
R9341:Cacna2d3 UTSW 14 28,704,315 (GRCm39) missense possibly damaging 0.92
R9343:Cacna2d3 UTSW 14 28,704,315 (GRCm39) missense possibly damaging 0.92
R9567:Cacna2d3 UTSW 14 28,627,268 (GRCm39) missense probably benign 0.38
Z1088:Cacna2d3 UTSW 14 28,786,265 (GRCm39) missense probably damaging 0.99
Z1177:Cacna2d3 UTSW 14 29,069,120 (GRCm39) missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TGAGATTAAGCCGACATGGG -3'
(R):5'- TGTCATTCTCAGAGGACAAAGG -3'

Sequencing Primer
(F):5'- AGCCGACATGGGATACTTATCTG -3'
(R):5'- GTGACCCACGTGGAAAGTTACTC -3'
Posted On 2015-10-08